TCPDF error: Image file has no extension and no type was specified: data:image/jpeg;base64,/9j/4AAQSkZJRgABAQEASABIAAD/4R0yRXhpZgAATU0AKgAAAAgAEQEOAAIAAAAgAAAA2gEPAAIAAAAgAAAA+gEQAAIAAAAgAAABGgESAAMAAAABAAEAAAEaAAUAAAABAAABOgEbAAUAAAABAAABQgEoAAMAAAABAAIAAAExAAIAAAAgAAABSgEyAAIAAAAUAAABagITAAMAAAABAAIAAAIgAAQAAAABAAAAAAIhAAQAAAABAAAAAAIiAAQAAAABAAAAAAIjAAQAAAABAAAAAAIkAAQAAAABAAAAAQIlAAIAAAAgAAABfodpAAQAAAABAAABngAAA0IAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFNvbnkAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAARjMzMTEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABIAAAAAQAAAEgAAAABTWVkaWFUZWsgQ2FtZXJhIEFwcGxpY2F0aW9uCgAAAAAyMDE3OjExOjI0IDEwOjMwOjEyAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABmCmgAFAAAAAQAAAtCCnQAFAAAAAQAAAtiIIgADAAAAAQAAAACIJwADAAAAAQCAAACQAAAHAAAABDAyMjCQAwACAAAAFAAAAuCQBAACAAAAFAAAAvSRAQAHAAAABAECAwCSBAAKAAAAAQAAAwiSBwADAAAAAQACAACSCAADAAAAAQD/AACSCQADAAAAAQAAAACSCgAFAAAAAQAAAxCSkAACAAAAAjY0AACSkQACAAAAAjY0AACSkgACAAAAAjY0AACgAAAHAAAABDAxMDCgAQADAAAAAQABAACgAgAEAAAAAQAAEACgAwAEAAAAAQAACQCgBQAEAAAAAQAAAxikAgADAAAAAQAAAACkAwADAAAAAQAAAACkBAAFAAAAAQAAAzikBgADAAAAAQAUAAAAAAAAAAB1NAAPQkAAAAAUAAAACjIwMTc6MTE6MjQgMTA6MzA6MTIAMjAxNzoxMToyNCAxMDozMDoxMgAAAAAAAAAACgAAAV4AAABkAAIAAQACAAAABFI5OAAAAgAHAAAABDAxMDAAAAAAAAAAAABkAAAAZAAAAAgBAwADAAAAAQAGAAABEgADAAAAAQABAAABGgAFAAAAAQAAA6gBGwAFAAAAAQAAA7ABKAADAAAAAQACAAACAQAEAAAAAQAAA7gCAgAEAAAAAQAAGXECEwADAAAAAQACAAAAAAAAAAAASAAAAAEAAABIAAAAAf/Y/9sAQwAIBgYHBgUIBwcHCQkICgwUDQwLCwwZEhMPFB0aHx4dGhwcICQuJyAiLCMcHCg3KSwwMTQ0NB8nOT04MjwuMzQy/9sAQwEJCQkMCwwYDQ0YMiEcITIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIyMjIy/8AAEQgAWgCfAwEhAAIRAQMRAf/EAB8AAAEFAQEBAQEBAAAAAAAAAAABAgMEBQYHCAkKC//EALUQAAIBAwMCBAMFBQQEAAABfQECAwAEEQUSITFBBhNRYQcicRQygZGhCCNCscEVUtHwJDNicoIJChYXGBkaJSYnKCkqNDU2Nzg5OkNERUZHSElKU1RVVldYWVpjZGVmZ2hpanN0dXZ3eHl6g4SFhoeIiYqSk5SVlpeYmZqio6Slpqeoqaqys7S1tre4ubrCw8TFxsfIycrS09TV1tfY2drh4uPk5ebn6Onq8fLz9PX29/j5+v/EAB8BAAMBAQEBAQEBAQEAAAAAAAABAgMEBQYHCAkKC//EALURAAIBAgQEAwQHBQQEAAECdwABAgMRBAUhMQYSQVEHYXETIjKBCBRCkaGxwQkjM1LwFWJy0QoWJDThJfEXGBkaJicoKSo1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2RlZmdoaWpzdHV2d3h5eoKDhIWGh4iJipKTlJWWl5iZmqKjpKWmp6ipqrKztLW2t7i5usLDxMXGx8jJytLT1NXW19jZ2uLj5OXm5+jp6vLz9PX29/j5+v/aAAwDAQACEQMRAD8A3YXZfH15JPC8LXFsPLRyCRgoOxI6Ia7q1/1Yrae5hT+Es4pjVBZEzCq8xBU0hng3iaT7D4tvm2K22cyDOepw1YEkxARgVyF4weaDJ7j5ZTIjNvWQ7lz1yeDSiREZWRNoPPXqOakCwrLuQs2MoAc5/wA/zp4QiNfLkz1BABJXPY/pUAPjwqZcBsggL/k8CtHR9Uk0Waee3aNpfJ2/MvT51zx9M1VOKlJJibtqao+I+qouPs9mxHqjf/FVmHx7rV3eSBXih5ZdsUfU8/3smvSjhKa1I9tJlWTWdRuWCXNxM2QRtmc45z2PHQ1f05mhinxt/eQCNipB58zd29lraUYxjZGSbb1PYvDMIg8O2ajvGH/765/rV2+OLbGe+a8aprNndH4UZ974Llh1y2v4L4zQ2du/mC4YmQg+YRzjnrjtwK1bP7graUuZ3JjDlVi6Bk4zzjOK44/EXw0+uPpJv/KlH3ZpF2xOcZwH6fngHtnIqblqLexRHxE0KWZF8+aGCQkRXM0DJFJjPRiMdjj1qCDxokniWbRLq2MEhUvbTLKJEnAGSOOjD056HnpmedXsV7OVmzhfE+g39/4i1LULdIWtw6hUebYZWESkheDyMjriuc8SPYD7Lc2kNtB5mcRRw+WdmMjcAx5HAPfJxzis3L37Gkadqbfcw99zD5bzoYopV3RtkHI59O+O1Pg1DMpBLh0G4B+CTntVJp7GEqTjuamjzW82owrdDCO+AvbocA8c84rvNZsZo/CzXcKqzxxD7P5r7doPOdx5XHHQgcAVhWvzI3oQUos4dJTIUjdvKl6PmQHZ0zn15J/wq2nm2xM0MoHBBaOQHGVbAyP93NdNGzmjknFx3GSX189sub2Qku3Wf2HvVC9kdr6bMhcozAktnjeR/hXsU+S94owafUtxxx7HJni3GNeMNkdPbFbulFF0q8jODIZoGU+22TP8xTnrEhLU9q0iJoNGs4m+8kKqfqBinagfkQV4c9W2d62R0cl1aM8lu0jeZKDFl4yBnHAJxj+IYz1zxWHa3MCW7ytMgRFLsc5wAMk/lW7hKO4uZS2PCY7BfE+q6h4ka8uEu5Jt1vJBPtaJvlZSuTngEADPAWq66vYar4C/0+8Mhs7YRLAwVWWRVCpt43ehzyMHB7iuecm20ejRpxUU+6ZmajrNre+E9HWOONbqOURSsF+WIJt+faOuQB29a2ZvK8TwxWVw3kahHA5SSJf3bSjqoAGRnr2HX2zm+7NIUpVISlDokJq9xfeF/DP2HUHa52yYRWBXrjcnPUZRccdjiqXgnTLS4sJL6/g066MxZP8ASm2+Vyx9MZJA5PQdDyanmfK5GVtVEzbu3s9L1/UdCvI4kVUmWBiw2xOw3Rlm64xgcn+XO9p/hLSrDw9b6rq0lwk8QSSQEeYgBPK7cE8A447nNPmaS8yeXmv5FeOSx/tJ7mzhjikRgItozs6YIHQHpyO+au6rruo3COLm5DwLGZGjxtBwCQDgcg4NXUppmNOs09Sylxpk3hLSInVnW6nhhbaoVmlyoclsZ/hfnvnGfSnE2mya3Fo8VkI4WuyspeZh5hRZMDdyVBPHHrTpR0lLsFZJyiN8caXY6RNbGzWKLzleQwoSdqjgNntnnj2NcVay4RgxJLKMnPuDXoZdNunZ9znxcUp3RpRtgE46EL1/z6V1Wl2wfRYrsH95LcPCV/3Fjx/6Ga7akrWONI90g/1Ke4zVPUDmQewxXhPqd3Yq+GvElxrugXMo0+GK1WaYAxghUIaIoOMc4kY5GPu57msLXfHGn6HdtpF7Zw3Vm0Ja4UjLZYHaBngjC8j/AGvz9WvQtUcE76nPRqe4pNHiviPUrGDVLhPDd3LFYXbfvoEVkC8ngZ7EHp+GccVUtbRxZyRMgLHcEOcg8dP1FeXUTjvufQ4GPPJuOqS/M7D4W+GxquvS2lwgktxJGxDKGDKNxOQexHHTHPPUAweLbW20DxTPY2ts1osE43wedvK8LtIOSPmQqcdjx2rOd3G6KwvuVXCT6M5jXtYuNd12KXUHKWbFQsUbHaijsPU89fft0Gnda7/YeufafDht44XQLNbsEC71J+YdhwRj1zyKLXSXQ4asfZTkr3aZR0PRLjxDfrZXksa3U9w08ru+ZmXI3Y4wP4jz1PbvXpPivw62mfDqZf7SWCG1SM70UszlWAjU8ZAyRyDnP4gtptq2xjGSSd+pwUdqNN1oW321LyMqjh0G3rjqMnB/EgjB71bvruKe2ulG0lR5bHdzyAB/6GapNyRm4qMrGBCZJbKZXvLk2sfzm3Ejbeo/Act1x1Fa3hLQ9R8Z3Ytw7RW0Dh57lcBxk5GD1LdfyrZR91qIN2d5HWeJfBlxZasmp396s/2mRUVVBG8BRkkHOOgGMnj9PLopJ32bY8s2AoVOT27DnmumhBUoc19zGpP2kmuxpRzusrrNEQ7NkrICCP5etd54djMb6Y7IDDc3AmVOenmbD/6BW8pJxTT3MLWZ7ZEMQx/7o/lWXqc6Ql5HOEBGT+leQ9jr6nH+BbyG38H2UNxcLE0+oSSIuwM0p8oKFGR8vIJLegI/irgfivqENxrojiJPlrsJUAAsOo46kd/TGPr9Bik41G35nn4eXNG3mcz4UtdLvNQm/tj7YscMYmE9vtbZhgPmjKNvBLL6YGc56V1l5qvgKKeKGCTVlUJhjAnyZ/2hIN2enQYrxq0ZTloe/gcW8MnJLRnqPwuksnv3jsJbiSz8lpE+0ptbeCFJAwMDB7AdTXkmri31b4n+KPt10BDDcTyKFuI4mm2yBFVZJCEXAO45zwh4qErxsyatacMQ6ltWJe+BL6db2eyhhSy0mORbmS5kPmOVzubYBx8u11xxtdcseawLTSYZ5NszSK4+7g4GMfz4qZe6tDmlN1JXkdJB4NvzBbaymp21hErP5Rc/OFyQWY8dx+VS+NPEl1e6Jb6VLbuyfaXad4m2pLHEAcRsQeGADDrjjrwTMJ+9ysudO0FNHC2V9LJcSzyHfNI5dyABkk5JwOlX0zJZ6j5o3Boy4APcYPP5Cr6mJmxXDG2ky5G/73Ax37Y967bwJqV9omnzXNnEXWaENtwCDtJBPUYwWP6V0RlGKae7svxJs5PXZHWXN/f+I9ThleKQ2tsC6BsBgOM9Bx0A6msDS/hZrcEy3iQm6j27lDFU3Z+rdx6+tPFt06KpN62f4mVO05OUVoS+K/Dt/ZPaSJpSW0LARPIroTuyWwFU8dCd3XtwOvUeB9QS20+10u4hdriRcL8i7VUF5Ac9c5aufC05fVlGTvLf7ht2menheQBXNa7hrSVScbmwPzzWFR2ptm8VeaPH/D2ozQeINMTO+G13hUPbepBP6/pVDxXaFta1K5mt5GhidwXC7CCTlR7glhnHOD+X1mYRSafkeThn0OUgDR6dPMd6Gd/JU7DtcAbnAbpwfLyOvzDtW3p/iO3hgRnti20jspx75PPpXh1I3se/gcXHDt8yvc9Z+DWvrqnii8gMCRMbMuDu3M2GUcHAx16c141Ya7Jpuv6hd3sL3ElxuWeM+XhyXDHcHjcEZUHGAcjqKy5baGeJr+3qOpax6D4Zv9V+IbazbQS2lgI7KVyJbiUhg/ysSSWAHI6AccdMY87tdft7eJEMcxZRjIA5P51FSHNFJGEXZs9j8Pm91fwfDPqGhiyYIbMI8RLzRN5bB1DAYBJPsTz9Oa8daY6ajBLcQwpF9mvUjKqQzlYHIJP+8MgD3z786jarr2Ot1P3Nl1PKNS0y+0m6FrqFpNa3ARXMUyFWAIyOD7Gui8K2lpJpd7cvc7bhWwY9wGEAzuPfHUZ9q1qNqN0ZUYpzSZ0NlqFktm4t7bZM6lYWeMKJW7bW6Hmo/C3jFvBhutKu9Mt75EkYCRG2EZ+8CSp3D6gfiMYMPZyaLxbXKmjqG+K2nHw1fw22gm0CxrtWKcYc71GD8owME889BV0fGiC0sIHi0KdoXg/dGS5VS+1th4AbA4PPt9cbVKLlOzZxwkktEYWu/EAeKrSKBNO+zBX87Pn7+m4YxtHrmut8HwxXHiGxkbZtS0jbAYHkRqp/UmtlB04WfmZ3vI9Ld1XOK5LWvmiiGed+frwf8a8yt/DZ10/jR5fpWhahb+dO1pMZiPkXYQSce/Sun1yGBfDHiKKSMJPdeVOocjcqgfd787lavrcfVhOyg72v+h4mHhJNykrbHlmm6Ylz4ttbFlRI5GjyQvQNj/GqmtaTFoXim80mcsLWO4G1s5PlNypzjrtI7da8eb1R6UdjpfhNePZfEDRzv2ZnaB/cMpXH54pfHvg6aD4gatFG6oZXa62s44DsTgE4z1HHXms2k5pMq9otkvw1BsGvLtpHWLygbhMna6Bs7GGec/nxx1rY+D9homnaXd69qogjvN6pbTXJTZCgOC6kn5SzfKGIAyu1SSSKdRWjoRCV5O53d/4l0a82z2/iLSQDgtvvlA3DGTnJ6gDj8etXJ9Q0L+yog8iahYzhlLJiSOcs3C7/ALgyxwNzAZI5rgdNufMzs9ouRRR4j8RZNT8T6vrGsXMUaHSPs1nKA+5mDB8SMdq4JYcrtUruAKgg1zOkwwWdob6/unhhkUiO3jGZLjnBwAQFUf3m6ngBsNjdJWsyHL3ro9i1fUNNsfDtnPf3Miwz3KiCUAHYdpYHgcrgFPo31Nea3uiXV34WPiBZfMjl1GS1lxj5XCI6nOedwZu3Gz3pYVK0mGJldpdCvPEqeFZpDhSyrj3+df8A69c/FPKTGpdmVF2opOQoyTge2ST+Jrpk/fRzU17rOj0ZA0F05UgpEMFfdgD+hr2TwxZfZvEsrRiVYULxxsyYVgG7Hv8AdrSvK0fkKCvI7e5nxC+Dzg4rmtXcG4iIblVb5frj/CvIr/wzspfGYP8AwmOmI2PLuG9wg/qa5/xt4phuNC/0RJ1Zj5biQAKynkg4POCFP4V7UU+a5wcyascjoGovH42tLiK1a4YLjyQDkkRH0B6Hnp2rX8eWd1rNzZ6i2nyWr4MEgfnI6qc4Hq35VnLV2LTsc9o0Oo2mvSX0EYN1YXgmaMHcA6PuHIyOoI/A17vosPh74m3lxeXYaPUoEYGFJF2EkbC4wA5ClRwWwOP7xqLac66FN/YfX/hzy/W7C58K3t/p8x8qQuDIEcMpyAR/Mn2zXUWWjyaf4F8M2Ucry3C27XcflrJL8zhpRsCSR4O3PzHLYPBFFdq0V3JoRbcn2HwrdxsXaS/khC7iqNec8dity/6K9chGt/aeInvNRvZQst15cSXCM7Rxt1bFxFkgKduRg9QeCM890tjotc6vx9o9svw71y/aa3EyywrFEDhljDQqBjuM7sZ6AhRgKAPP7rQfD95b28UV8thcrDHIXdGIdCmQXHQEjBzxwScHIxhzzsmtTZQhdqTsXNe8CXY8NWdzpt5PqKWkLyyq1wrRpHsVmaMcYGQeMkkFMVgySpbaVpkLWt1BP+987zn+Ridm10TA2naBkknOB0ralNOSS0MasWk+ps3Wlpe6KtrG/wC93ElcYOQeO3cVgHw1c4JiGSvUdv8A61XOpZxl3M6a0a7M07GzvrKe1tpkVRe7FQhg38W3t0OQeD9a73wl4p23zQahc4SJcp8hPqD0HuK2rKMoXXYULqR1v/CS6fdyPBDc5kAyAVI3cjgZ74yfwNY19eK2os+7PyBSPzP9a8zEJqB1UdZnSx2lugwIh9K8++MFuBodhJF8pWcqUB5II649BgDPuPWvVTs7nCjzzwrfXFt490i4H+ukuY4zlccSYQ8Y9GNe3eLYV/sWe6eOST7OhYRR9zkHOOmQAefQmp5tbltbIwvD+h6PNpketRBoprmFpJnaTIYtgkMT6EHnjvmtjwFrGmWHii6kWa2ImjWGa4LjEHlo5I3dMECLocfKfSqppyTj5EVHyvmZx/iYf8Jxrt3qUU8ENg7tEGSNhkKvHUKck88gH64r0PUZ7HR/sOrJI40NbMRRwxjJ/hVB3GV5IB43AHPFZVpe9FdjWjH3ZeZ5Jr/ivSZtQme303zcqOZbS0VQ3ps8pm2jsC+QMDPcoNcg1SzS3t7i4hkwA0RUJDtHQKithQCAeBzgelJ0nKVkw9olG7PSr+Hw/wCMbNrG4iuFijmWWJDhHnQEHYCuQG6r1yeox0Hk09ld2evX8VxG0MscEZETsW8tVQYXnJ2gALg84rLkdNuLNHNVIqSKf2fXdI8U2mj3bzRXME6psBO5EbgqCfmCFSfl6Edq6nxy2n3MsiyJctdJNEplWZQpIUIw2lc569+3Sofu1Ey1rTt5kLGQ3VlOkMcTN8kiq554z1Y84wa0I4UcbkIZScBsEZ/Pn86UmnTiu1yFG02+5bjswxXKg4OR/Or+n6VDFL5sdvGHAwpK/d5/zweKi7sXZFyXSo3nNy0cYmJzmOJUxx2CgAfhVOTSyXZlZgxPJznP51nU1VmXDR6HaLKvQGuH+K9s1z4TW6iLB7WZSxVyPkbgjHfnb+X1r1GcK3PP9O8GazrekafqVrcQLGEYRAyMrjbI3Q4x1z3r0Kyj8YatoF5Za4beB22iKdQC7DOW3BSB0wBjHepZaepPpPhmLT7NYDcmRwmCwGBn6V5rqv2vQNZuoo453g2bC65VHJAJIyCM44796qg+SVyaj542ZN4X1P7VbC1kuEV43eTy8MSc4+bOcAcjjHvXsXhCCTUPD11pcii4tjEWWM5ZgW9Pbrn3I96ia54Sk9yoPlqRj0PFNZ8JXVvfagiSAiBpGHmAqWUZIOSACSAMYJ69q5m1vJbK43KuCDypOKmnN6SRU4LWLPUfA3iu0N7aregrAJUE4kwwC7gCR68e1dx8RY9LuvFFjqVnMy3VrseSe02yYQOpUkMpUkEEgZxjr1q8S7tSRGHjZOJxerPouj+I/wC2LjzftdjASI7hwpuG2gINqglTjgkluo6bTXN2UF14gijuZrncwkZpMryzE5JyMYPJ+lcj1u2dF7JI1Z7JEmtreUOIR91QjNnHYkD/AD711EFozKrMu3PRcdKh7DNe00qWSNpEhdo0+8wXIFbuj6K19KY1dEYjPzd6aV2K5uv4NYR5W4Vm/u7P/r1Qbw9DExWQybu/QVTop7i52jnlL54NYvi7TNQ1Pw9cWtlGJpXK/IWAyAQe/Hau3mOaxW8L6NqOmaJa2t0wjeMNlEbIGWJx+tdY8bC35YnNY7mjK625Xkk1j65ocOo2Mtu4GHGAfQ9j+dOOjuSzgW8E6hpmoxSacQ6kjzHdgABnp6k++BXWRX+s+HNPludP8oTRrHtG0nbtPbkdckYPHPtVyfMnFaXCLtJSe6OY/wCEgu7q0Vnty9864cKuAPTH4YrN0XRb3S5ZJrq1t5Y3I2O+1jkE8gdRnk8gdBXPdJWXQ2ad7vqdX9qkuGOX79MU+SzVpY5GaUMo3YSRlBz2IBAb8axuy9Cy+nwX8ryXECSO/wB4uuc1oWmkwWy7be3jjHXCqBQm2DsjYttEvr0qYLWRwDjKqSBWzH4Q1QY3WoHv5i/41Sg2Tc7LQ7eewsbeyniAIV2JBzj5hgceuT+VXo7G1iculvGrE5zt6fT0rWK7hLyHzTiOCSREaYx9UjwWPt9apJfWV9EGlQqP9tSCD6e1NNMfI+TnPN4QMdKsD7jfQ1r0OcgfoPrVp/8AVj61mMjb7i1Vuf8AUk98U0DKR/1f4mprCOOW8RJEV0aRQVYZBGRVroQc6LaCLWZFjgjRQikBUAAyKz9eZkez2MV3H5sHGaxppfmbzYjQRNE7NEhbYeSoz0rVg5C5/uj+QrGRUTUt1HHA6eld34StLa4WbzreKTGMb0Bx+dVDcHsdkqhVCqAFAwAB0pa2JE/iFLSXUDElZl8Q4ViMsoOD14FbTKrDDAEehFZUuvqXPof/2QD/5R4i+/r5+AYABwAkAAAAdAAAAGQGAABsDAAAHA0AAHQNAADMDQAAAAAAAQAAAAABAAABCAAAAAIAAAEFAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAEAAAABAAAEAAAAAAIAAAQAAAAAAwAABAgAAAAEAAAEAAAAAAUAAAQAAAAABgAABAAQAAAHAAAEAAkAAAgAAAQCAAAACQAABAAAAAAKAAAECAAAAAsAAAQAAAAADAAABAAAAAANAAAEAAoAAA4AAASgBQAADwAABAAAAAAQAAAEAAAAABEAAAQAAAAAEgAABAAAAAATAAAEAAAAABQAAAQAAAAAFQAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAD/5u9SA/Lx8AYACQAsAAAALCAAAFxAAACsVgAAjIYAAKyJAAC0kwAARMUAAEztAAAAAAABAAAAAAEAAAFVAAAAAgAAATR1AAADAAABJAUAAAQAAAEABAAABQAAAYAAAAAGAAABTQEAAAcAAAEnAAAACAAAAQQCAAAJAAABAAAAAAoAAAEAAAAACwAAASROAAAMAAABgBEAAA0AAAEHBAAADgAAAbgBAAAPAAABLAEAABAAAAEhAAAAEQAAAQQCAAASAAABYAAAABMAAAEkTgAAFAAAAYARAAAVAAABBwQAABYAAAG4AQAAFwAAAR4AAAAYAAABIQAAABkAAAEEAgAAGgAAAQEAAAAbAAABAQAAABwAAAHrAwAAHQAAATR1AAAeAAABQAUAAB8AAAEABAAAIAAAASROAAAhAAABgBEAACIAAAEABAAAIwAAAQEAAAAkAAABAAAAACUAAAEUAAAAJgAAAQAAAAAnAAABAQAAACgAAAFbAAAAKQAAAVUAAAAqAAABKQAAACsAAAEpAAAALAAAAQEAAAAtAAABAAAAAC4AAAECAAAALwAAAQAAAAAwAAABAAAAADEAAAEAAAAAMgAAAXAEAAAzAAABQDwAADQAAAFkAAAANQAAAREnAAA2AAABEScAADcAAAEABAAAOAAAAREnAAA5AAABAAQAADoAAAEAAAAAOwAAAQAAAAA8AAABOQAAAD0AAAEBAAAAPgAAAaAAAAA/AAABFAAAAEAAAAHcAAAAQQAAAVIAAABCAAABGgAAAEMAAAEBAAAARAAAAQEAAABFAAABAQAAAEYAAAFaAAAARwAAAfj///9IAAABQAAAAEkAAAFAAAAASgAAAQMAAABLAAABQAAAAEwAAAEDAAAATQAAAUAAAABOAAABAwAAAE8AAAGgAAAAUAAAAQAAAABRAAABoAAAAFIAAAEAAAAAUwAAAQAAAABUAAABAQAAAFUAAAEAAAAAVgAAATIAAABXAAABAAAAAFgAAAEBAAAAWQAAAQAAAABaAAABMgAAAFsAAAEAAAAAXAAAAQEAAABdAAABAAAAAF4AAAEyAAAAXwAAAQAAAABgAAABEgAAAGEAAAFLAAAAYgAAAQAAAABjAAABAAAAAGQAAAEAAAAAZQAAAQAAAABmAAABAAAAAGcAAAEAAAAAaAAAAQAAAABpAAABAAAAAGoAAAH1AAAAawAAAQAAAABsAAABAAAAAG0AAAEABAAAbgAAASgAAABvAAAB6wAAAHAAAAFLAAAAcQAAAXgAAAByAAABeAAAAHMAAAHQBwAAdAAAAQAEAAB1AAABYAkAAHYAAAEAAAAAdwAAAQEAAAB4AAABCAcAAHkAAAEKAAAAegAAAQAEAAB7AAABUAAAAHwAAAEAAAAAfQAAAQAAAAB+AAABpwAAAH8AAAEIAAAAgAAAAQAAAACBAAABAAAAAIIAAAEAAAAAgwAAAQAAAACEAAABLwAAAIUAAAHkAQAAhgAAAQAAAACHAAABAAQAAIgAAAEKAAAAiQAAAcgAAACKAAABAQAAAIsAAAFqAAAAAAAAAAAAAACNAAABFwAAAI4AAAEABAAAjwAAAS8AAACQAAABAAAAAJEAAAHcBQAAkgAAAQAAAACTAAABNAgAAJQAAAEABAAAlQAAAQAAAACWAAABAAAAAJcAAAEAAAAAmAAAAQAAAACZAAABMgAAAJoAAAEAAAAAmwAAAf39//+cAAABAAAAAJ0AAAEAAAAAngAAAQAAAACfAAABAAAAAKAAAAEABAAAoQAAAZABAACiAAABHAAAAKMAAAH/AAAApAAAAQABAAClAAABmAgAAKYAAAEAAAAApwAAAaAPAACoAAABAAQAAKkAAAHYDgAAqgAAAQAAAACrAAABiBMAAKwAAAEABAAArQAAAQkAAACuAAABAAAAAK8AAAEAAAAAsAAAAYcFAACxAAABHQEAALIAAAEmEAAAswAAAQAAAAC0AAABAAAAALUAAAEBAAAAtgAAAQUAAAC3AAABoAAAALgAAAFIAAAAuQAAAcgAAAC6AAABVgAAALsAAAH0AQAAvAAAAQUAAAC9AAABFwAAAL4AAAEyAAAAvwAAASwBAADAAAABsAQAAMEAAAEABAAAwgAAAWAJAADDAAABAAAAAMQAAAEM/v//xQAAAQAEAADGAAABuAsAAMcAAAEAAAAAyAAAAQEAAADJAAABYPD//8oAAAEABAAAywAAATD4///MAAABAAAAAM0AAAH/AAAAzgAAAQAAAADPAAABBAAAANAAAAHoAAAA0QAAAQwAAADSAAABAAAAANMAAAGgAAAA1AAAARUAAADVAAABFQAAANYAAAEmEAAA1wAAAQAAAADYAAABVgAAANkAAAEUAAAA2gAAAQEAAADbAAABAQAAANwAAAEBAAAA3QAAAQEAAADeAAABAAAAAN8AAAEAAAAA4AAAAQEAAADhAAABAQAAAOIAAAEBAAAA4wAAAQEAAADkAAABAQAAAOUAAAEBAAAA5gAAAQEAAADnAAABeAAAAOgAAAFQAAAA6QAAAQUAAADqAAABBQAAAOsAAAFQAAAA7AAAAXgAAADtAAABMgAAAO4AAAEoAAAA7wAAATIAAADwAAABKAAAAPEAAAEBAAAA8gAAAQEAAADzAAABAQAAAPQAAAEBAAAA9QAAAQEAAAD2AAABAQAAAPcAAAEBAAAA+AAAAQEAAAD5AAABAQAAAPoAAAEBAAAA+wAAAQEAAAD8AAABAQAAAP0AAAEBAAAA/gAAAQEAAAD/AAABAQAAAAABAAEBAAAAAQEAAQEAAAACAQABAQAAAAMBAAEBAAAABAEAAQEAAAAFAQABAQAAAAYBAAEBAAAABwEAAQEAAAAIAQABAQAAAAkBAAEBAAAACgEAAQEAAAALAQABAQAAAAwBAAEBAAAADQEAAQEAAAAOAQABAQAAAA8BAAEBAAAAEAEAAQEAAAARAQABYAAAABIBAAEwAAAAEwEAAQAAAAAUAQABBAAAABUBAAEAAAAAFgEAAQgHAAAXAQABAAAAABgBAAEsAAAAGQEAATIAAAAaAQABIwAAABsBAAEmAAAAHAEAATIAAAAdAQABLwAAAB4BAAEyAAAAHwEAATkAAAAgAQABOwAAACEBAAE2AAAAIgEAAQMAAAAAAAAAAAAAACQBAAEAAAAAJQEAAQAAAAAmAQABAAAAACcBAAEAAAAAKAEAAQAAAAApAQABAAAAACoBAAEAAAAAKwEAAQAAAAAsAQABAAAAAC0BAAF4AAAALgEAAVoAAAAvAQABAAAAADABAAF3AAAAMQEAAQAAAAAyAQABWQAAADMBAAExAAAANAEAATgAAAA1AQABJQAAADYBAAEuAAAANwEAAQEAAAA4AQABAQAAADkBAAGCAAAAOgEAAS8AAAA7AQABGQAAADwBAAHSAAAAPQEAAQ8AAAA+AQABtgMAAD8BAAEDAAAAQAEAAZEAAABBAQABtAAAAEIBAAEoAAAAQwEAAQAAAABEAQABAAAAAEUBAAEAAAAARgEAAQAAAABHAQABAAAAAEgBAAEAAAAASQEAAQAAAABKAQABAAAAAEsBAAEAAAAATAEAAQAAAABNAQABAAAAAE4BAAEAAAAATwEAAQAAAABQAQABAAAAAFEBAAEBAAAAUgEAAQAAAABTAQABAAAAAFQBAAEAAAAAVQEAAQAAAABWAQABAAAAAFcBAAEAAAAAWAEAAQAAAABZAQABAAAAAFoBAAEAAAAAWwEAAQAAAABcAQABAAAAAF0BAAEAAAAAXgEAAQAAAABfAQABAAAAAGABAAEAAAAAYQEAAQAAAABiAQABAAAAAGMBAAEAAAAAZAEAAQAAAABlAQABAAAAAGYBAAEAAAAAZwEAAQAAAABoAQABAAAAAGkBAAEAAAAAagEAAQAAAABrAQABAAAAAGwBAAEAAAAAbQEAAQAAAABuAQABAAAAAG8BAAEAAAAAcAEAAQAAAABxAQABAAAAAHIBAAEAAAAAcwEAAQAAAAB0AQABAAAAAHUBAAEAAAAAdgEAAQAAAAB3AQABAAAAAHgBAAEAAAAAeQEAAQAAAAB6AQABAAAAAHsBAAEAAAAAfAEAAQAAAAB9AQABAAAAAH4BAAEAAAAAfwEAAQAAAACAAQABAwAAAIEBAAEAAAAAggEAAWQAAACDAQABAAAAAIQBAAFkAAAAhQEAAQAAAACGAQABdwAAAIcBAAEAAAAAiAEAAVkAAACJAQABAAAAAIoBAAEDAAAAiwEAAQAAAACMAQABZAAAAI0BAAEAAAAAjgEAAWQAAACPAQABAAAAAJABAAF3AAAAkQEAAQAAAACSAQABWQAAAJMBAAEAAAAAlAEAAQQAAACVAQABAAAAAJYBAAFkAAAAlwEAAQAAAACYAQABZAAAAJkBAAEAAAAAmgEAAXcAAACbAQABAAAAAJwBAAFZAAAAnQEAAQAAAACeAQABBAAAAJ8BAAEZAAAAoAEAAUsAAAChAQABGQAAAKIBAAFLAAAAowEAAR4AAACkAQABWgAAAKUBAAEWAAAApgEAAUMAAACnAQABbgAAAKgBAAE1AAAAqQEAARQAAACqAQABFwAAAKsBAAE7AAAArAEAAUkAAACtAQABIgAAAK4BAAEZAAAArwEAARoAAACwAQABPQAAALEBAAEeAAAAsgEAATQAAACzAQABIwAAALQBAAEjAAAAtQEAAUQAAAC2AQABKQAAALcBAAFDAAAAuAEAASkAAAC5AQABGQAAALoBAAEvAAAAuwEAATMAAAC8AQABKwAAAL0BAAEiAAAAvgEAATIAAAC/AQABlgAAAMABAAEAAAAAwQEAAQAAAADCAQABAAAAAMMBAAFBAAAAxAEAAU0AAADFAQABZQAAAMYBAAGzAAAAxwEAAc4AAADIAQABHAEAAMkBAAH3AAAAygEAAeIAAADLAQAB/AAAAMwBAAEIAQAAzQEAARIBAADOAQABNAEAAM8BAAFgAQAA0AEAAQ0BAADRAQAB6QAAANIBAAHvAAAA0wEAAdsAAADUAQAB2wAAANUBAAG7AAAA1gEAAZoAAADXAQABiAAAANgBAAGBAAAA2QEAAZkAAADaAQABbQAAANsBAAF2AAAA3AEAAVYAAADdAQABbAAAAN4BAAFrAAAA3wEAAV0AAADgAQABVwAAAOEBAAFTAAAA4gEAAWEAAADjAQABXgAAAOQBAAFhAAAA5QEAAToAAADmAQABUAAAAOcBAAFZAAAA6AEAAQAAAADpAQABAAAAAOoBAAEAAAAA6wEAAUkAAADsAQABQAAAAO0BAAFfAAAA7gEAAYgAAADvAQABugAAAPABAAHoAAAA8QEAAQUBAADyAQABEwEAAPMBAAHmAAAA9AEAAegAAAD1AQAB7wAAAPYBAAEAAQAA9wEAAeAAAAD4AQAB/AAAAPkBAAH8AAAA+gEAARkBAAD7AQABJQEAAPwBAAHuAAAA/QEAAfYAAAD+AQAB3QAAAP8BAAG3AAAAAAIAAaQAAAABAgABlQAAAAICAAGWAAAAAwIAAYIAAAAEAgABfQAAAAUCAAFuAAAABgIAAYwAAAAHAgABjgAAAAgCAAFwAAAACQIAAWcAAAAKAgABVgAAAAsCAAFWAAAADAIAAVsAAAANAgABWAAAAA4CAAFBAAAADwIAAUUAAAAQAgABAAAAABECAAEAAAAAEgIAAQAAAAATAgABTgAAABQCAAEzAAAAFQIAAVkAAAAWAgABaQAAABcCAAGnAAAAGAIAAbkAAAAZAgAB4QAAABoCAAHXAAAAGwIAAfsAAAAcAgAB/AAAAB0CAAEOAQAAHgIAAeAAAAAfAgAB7wAAACACAAHRAAAAIQIAASUBAAAiAgAB+wAAACMCAAECAQAAJAIAAcAAAAAlAgAB5AAAACYCAAGoAAAAJwIAAdAAAAAoAgABngAAACkCAAHOAAAAKgIAAa4AAAArAgABuQAAACwCAAGlAAAALQIAAa8AAAAuAgABkwAAAC8CAAF4AAAAMAIAAW0AAAAxAgABdAAAADICAAFgAAAAMwIAAW4AAAA0AgABaAAAADUCAAFwAAAANgIAAWQAAAA3AgABZgAAADgCAAEAAAAAOQIAAQAAAAA6AgABAAAAADsCAAEAAAAAPAIAAQAAAAA9AgABAAAAAD4CAAEAAAAAPwIAAQAAAABAAgABAAAAAEECAAHYAAAAQgIAAd0BAABDAgAB0wMAAEQCAAGaBQAARQIAAakFAABGAgAB+wUAAEcCAAFDBgAASAIAAeQFAABJAgABBQYAAEoCAAEeBQAASwIAAS4EAABMAgABvwMAAE0CAAFiAwAATgIAAQEDAABPAgAB7QIAAFACAAFiAgAAUQIAATkCAABSAgABJgIAAFMCAAH5AQAAVAIAAckBAABVAgAB0wEAAFYCAAG7AQAAVwIAAZwBAABYAgABnAEAAFkCAAG7AQAAWgIAAagBAABbAgABlwEAAFwCAAGVAQAAXQIAAX0BAABeAgABngEAAF8CAAF5AQAAYAIAAS4BAABhAgABKgEAAGICAAEGAQAAYwIAARoBAABkAgABDwEAAGUCAAHzAAAAZgIAAegAAABnAgABDQEAAGgCAAH7AAAAaQIAAe8AAABqAgAB3AAAAGsCAAHqAAAAbAIAAcsAAABtAgABpQAAAG4CAAGlAAAAbwIAAYwAAABwAgABiQAAAHECAAGRAAAAcgIAAaUAAABzAgABygAAAHQCAAHOAAAAdQIAAb0AAAB2AgABtgAAAHcCAAH5AAAAeAIAARABAAB5AgABywAAAHoCAAGzAAAAewIAAYgAAAB8AgABjAAAAH0CAAFvAAAAfgIAAWUAAAB/AgABZwAAAIACAAFvAAAAgQIAAVEAAACCAgABUgAAAIMCAAFCAAAAhAIAATAAAACFAgABIwAAAIYCAAEfAAAAhwIAARcAAACIAgABEAAAAIkCAAEWAAAAigIAARcAAACLAgABEQAAAIwCAAELAAAAjQIAAREAAACOAgABBwAAAI8CAAEPAAAAkAIAAREAAACRAgABEAAAAJICAAELAAAAkwIAAQsAAACUAgABCgAAAJUCAAEOAAAAlgIAAQ4AAACXAgABDQAAAJgCAAESAAAAmQIAAQsAAACaAgABDAAAAJsCAAEGAAAAnAIAAQwAAACdAgABCAAAAJ4CAAEDAAAAnwIAAQ0AAACgAgABDQAAAKECAAEMAAAAogIAAQsAAACjAgABDwAAAKQCAAEJAAAApQIAAQ0AAACmAgABCwAAAKcCAAEOAAAAqAIAAQwAAACpAgABCQAAAKoCAAENAAAAqwIAAQkAAACsAgABCQAAAK0CAAEJAAAArgIAAQkAAACvAgABCwAAALACAAEJAAAAsQIAAQoAAACyAgABEQAAALMCAAEMAAAAtAIAARgAAAC1AgABHAAAALYCAAH5AAAAtwIAAQEAAAC4AgABAwAAALkCAAEIAAAAugIAAQYAAAC7AgABBAAAALwCAAEFAAAAvQIAAQMAAAC+AgABBQAAAL8CAAEqAwAAwAIAAQAAAADBAgABZAAAAMICAAG2AAAAwwIAAWYBAADEAgABDQIAAMUCAAHLAQAAxgIAAeEBAADHAgAB/gEAAMgCAAEZAgAAyQIAASMCAADKAgABtgEAAMsCAAF9AQAAzAIAAS0BAADNAgAB6gAAAM4CAAEPAQAAzwIAAf0AAADQAgABtQAAANECAAG4AAAA0gIAAaIAAADTAgABmQAAANQCAAGLAAAA1QIAAaUAAADWAgABjgAAANcCAAGVAAAA2AIAAYAAAADZAgABjAAAANoCAAGXAAAA2wIAAagAAADcAgABjgAAAN0CAAGBAAAA3gIAAY4AAADfAgABcAAAAOACAAFrAAAA4QIAAWkAAADiAgABWQAAAOMCAAE+AAAA5AIAAVcAAADlAgABTAAAAOYCAAFiAAAA5wIAAWEAAADoAgABUAAAAOkCAAE+AAAA6gIAAUgAAADrAgABTQAAAOwCAAFDAAAA7QIAAT8AAADuAgABMAAAAO8CAAEtAAAA8AIAASwAAADxAgABIQAAAPICAAErAAAA8wIAATAAAAD0AgABJwAAAPUCAAE3AAAA9gIAAVwAAAD3AgABcAAAAPgCAAFqAAAA+QIAAVIAAAD6AgABNgAAAPsCAAEjAAAA/AIAASUAAAD9AgABJQAAAP4CAAE3AAAA/wIAATsAAAAAAwABHwAAAAEDAAEYAAAAAgMAARAAAAADAwABDgAAAAQDAAEHAAAABQMAAQgAAAAGAwABDgAAAAcDAAEIAAAACAMAAQUAAAAJAwABBgAAAAoDAAEGAAAACwMAAQYAAAAMAwABBgAAAA0DAAEFAAAADgMAAQoAAAAPAwABAQAAABADAAEFAAAAEQMAAQUAAAASAwABAgAAABMDAAEEAAAAFAMAAQQAAAAVAwABBwAAABYDAAEEAAAAFwMAAQMAAAAYAwABAQAAABkDAAEEAAAAGgMAAQIAAAAbAwABAwAAABwDAAEEAAAAHQMAAQQAAAAeAwABAgAAAB8DAAECAAAAIAMAAQYAAAAhAwABAgAAACIDAAEEAAAAIwMAAQQAAAAkAwABCAAAACUDAAEFAAAAJgMAAQIAAAAnAwABAQAAACgDAAEGAAAAKQMAAQYAAAAqAwABCwAAACsDAAEEAAAALAMAAQYAAAAtAwABBQAAAC4DAAELAAAALwMAAQUAAAAwAwABCQAAADEDAAEHAAAAMgMAAQYAAAAzAwABCAAAADQDAAEGAAAANQMAAQgAAAA2AwABCgAAADcDAAEHAAAAOAMAARMAAAA5AwABIAAAADoDAAH5AAAAOwMAAQAAAAA8AwABAAAAAD0DAAEAAAAAPgMAAQAAAAA/AwABAAAAAEADAAEAAAAAQQMAAWEAAABCAwABegAAAEMDAAGtAAAARAMAAa0AAABFAwABsAAAAEYDAAGtAAAARwMAAbAAAABIAwABjgAAAEkDAAF9AAAASgMAAWQAAABLAwABdAAAAEwDAAFaAAAATQMAATQAAABOAwABOwAAAE8DAAEvAAAAUAMAATAAAABRAwABOAAAAFIDAAEmAAAAUwMAARwAAABUAwABIgAAAFUDAAEdAAAAVgMAARQAAABXAwABFgAAAFgDAAEeAAAAWQMAAR8AAABaAwABJAAAAFsDAAEeAAAAXAMAASQAAABdAwABIQAAAF4DAAEVAAAAXwMAAREAAABgAwABIQAAAGEDAAEVAAAAYgMAAQ4AAABjAwABDQAAAGQDAAESAAAAZQMAAQ4AAABmAwABDwAAAGcDAAEWAAAAaAMAAQwAAABpAwABEQAAAGoDAAEMAAAAawMAARUAAABsAwABEAAAAG0DAAEMAAAAbgMAARQAAABvAwABDQAAAHADAAEIAAAAcQMAAQMAAAByAwABCgAAAHMDAAEJAAAAdAMAAQUAAAB1AwABCAAAAHYDAAEHAAAAdwMAAQQAAAB4AwABBAAAAHkDAAEHAAAAegMAAQIAAAB7AwABAgAAAHwDAAEEAAAAfQMAAQUAAAB+AwABAQAAAH8DAAEEAAAAgAMAAQYAAACBAwABAwAAAIIDAAECAAAAgwMAAQEAAACEAwABAwAAAIUDAAEAAAAAhgMAAQQAAACHAwABAwAAAIgDAAEBAAAAiQMAAQIAAACKAwABAwAAAIsDAAECAAAAjAMAAQIAAACNAwABBAAAAI4DAAEBAAAAjwMAAQAAAACQAwABAwAAAJEDAAEBAAAAkgMAAQAAAACTAwABAQAAAJQDAAEBAAAAlQMAAQAAAACWAwABAQAAAJcDAAEAAAAAmAMAAQAAAACZAwABAQAAAJoDAAEAAAAAmwMAAQIAAACcAwABAAAAAJ0DAAEAAAAAngMAAQAAAACfAwABAgAAAKADAAEEAAAAoQMAAQAAAACiAwABAQAAAKMDAAEAAAAApAMAAQAAAAClAwABAQAAAKYDAAEBAAAApwMAAQAAAACoAwABAQAAAKkDAAECAAAAqgMAAQMAAACrAwABAgAAAKwDAAECAAAArQMAAQEAAACuAwABAQAAAK8DAAEBAAAAsAMAAQEAAACxAwABAQAAALIDAAECAAAAswMAAQEAAAC0AwABAgAAALUDAAEAAAAAtgMAAQEAAAC3AwABAgAAALgDAAEJAAAAuQMAAQUAAAC6AwABGwAAALsDAAEAAAAAvAMAAQAAAAC9AwABAAAAAL4DAAEAAAAAvwMAAQAAAADAAwABAAAAAMEDAAEAAAAAwgMAAQEAAADDAwABAAAAAMQDAAEsAQAAxQMAATIAAADGAwABAAAAAMcDAAEAAAAAyAMAAQAAAADJAwABAAAAAMoDAAEAAAAAywMAAQEAAADMAwABAAAAAM0DAAEUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACsAAAIBAAAASACAAhsnAAAhAIACkQAAACEAgAKlAAAAIQCAArkAAAAhAIAC1wAAACEAgAL6AAAAIQCAAh0BAAAhAIACOwEAACEAgAJZAQAAIQCAAnwBAAAhAIACqQEAACEAgALWAQAAIQCAAgMCAAAhAIACNQIAACEAgAJnAgAAIQCAApkCAAAhAIACywIAACMAAAKRAAAAJACAAssCAAA1AIACAAAAADoAgAKOAAAAOwCAAjAAAAARAAACDwAAABIAgAIKAAAAMgCAAgMAAAAyAIACAwAAADMAgAIAAAAANACAAtAHAAAXAAACAgAAAB8AgAIBAAAADgCAAlsAAAAsAAACABAAAC0AgAIACQAALgCAAgAAAAAvAIACAAAAABoAAAL0BgAAGwCAAtMDAAAcAIAC9gAAAB0AgAL2AAAAAAAAAgAAAAABAIAChwEAAAAAAAIAAAAAAQCAAnwBAAACAIACAAAAAAIAgAK42UAAAwCAAgAAAAAEAIACAAAAAAUAgAIAAAAAEQCAAjy6CQAOAIACWwAAADsAgAIuAAAAVQCAAjR1AABUAIACIwAAAAAAAAIBAAAAAQCAAlkBAAACAIACAAAAAAIAgAKS9EcAAwCAAgEAAAAEAIACAQAAAAUAgAIAAAAAEQCAAkoUCwAOAIACWwAAADsAgAIsAAAAVQCAAjR1AABUAIACIwAAAAAAAAICAAAAAQCAAjsBAAACAIACAAAAAAIAgAI8T0gAAwCAAgIAAAAEAIACAgAAAAUAgAIAAAAAEQCAAsXUCwAOAIACWwAAADsAgAIsAAAAVQCAAjR1AABUAIACIwAAAAAAAAIDAAAAAQCAAh0BAAACAIACAAAAAAIAgALsPTsAAwCAAgMAAAAEAIACAgAAAAUAgAIAAAAAEQCAAmcvDwAOAIACWwAAADsAgAItAAAAVQCAAjR1AABUAIACIwAAAEkAAAIAAAAASgCAAgEAAABLAAACAQAAAEwAgAJZAQAATQCAApL0RwBLAAACAgAAAEwAgAI7AQAATQCAAjxPSABLAAACAwAAAEwAgAIdAQAATQCAAuw9OwAKAAACSQEAAFIAAAIRAAAAUQCAAgAAAABRAIACDQAAAFEAgAIRAAAAUQCAAgYAAABLAAACAQAAAEwAgAJZAQAATQCAAiCZXwBLAAACAgAAAEwAgAI7AQAATQCAAkc8ZQBLAAACAwAAAEwAgAIdAQAATQCAAnWIVAAKAAACQgEAAAYAAAIDAAAACgAAAkIBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAwEAAAABAAADAQAAAAIAAAMwAAAAAwAAA1sAAAAEAAADNgMAAAUAAAMAAgAABgAAA2IDAAAHAAADHAMAAAgAAAP4AQAACQAAA2IDAAAKAAAD4QEAAAsAAAMAAgAADAAAA00CAAANAAADAAAAAA4AAAMIAAAADwAAA2QAAAAQAAAD8AEAABEAAAMAAgAAEgAAA/wBAAATAAADQgEAABQAAAMAAgAAFQAAAyoDAAAWAAAD9AEAABcAAAMAAgAAGAAAA/cBAAAZAAADAAAAABoAAAMBAAAAGwAAAwEAAAAcAAADCAAAAB0AAAMoAAAAHgAAAxIAAAAfAAADCgAAACAAAAMWAAAAIQAAA2QAAAAiAAADZAAAACMAAANkAAAAJAAAA2QAAAAlAAADZAAAACYAAANkAAAAJwAAA2QAAAAoAAADZAAAACkAAAMAAAAAKgAAAzkAAAArAAADZAAAACwAAANkAAAALQAAA2QAAAAuAAADZAAAAC8AAAMmAAAAMAAAA2QAAAAxAAADAAAAADIAAAMBAAAAMwAAAwEAAAA0AAADCQAAADUAAAMrAAAANgAAAxMAAAA3AAADBAAAADgAAAMXAAAAOQAAA2cBAAA6AAADAAIAADsAAAOZAgAAPAAAA84BAAA9AAADAAIAAD4AAAMJAgAAPwAAAwAAAABAAAADAAAAAEEAAAMAAAAAQgAAA60CAABDAAADjQAAAEQAAANkAAAARQAAA2QAAABGAAADZwEAAEcAAAMAAgAASAAAA5kCAABJAAADcwEAAEoAAAMAAgAASwAAA68CAABMAAADzgEAAE0AAAMAAgAATgAAAwkCAABPAAADZAAAAFAAAANkAAAAUQAAA3MBAABSAAADAAIAAFMAAAOvAgAAVAAAA5MBAABVAAADAAIAAFYAAAN3AgAAVwAAA84BAABYAAADAAIAAFkAAAMJAgAAWgAAAxYAAABbAAADAAAAAFwAAAMAAAAAXQAAAwAAAABeAAADAAAAAF8AAAMAAAAAYAAAAwAAAABhAAADAQAAAGIAAAOAAAAAYwAAA8AAAABkAAADwAAAAGUAAAMAAQAAZgAAA2QAAABnAAADZAAAAGgAAAOTAQAAaQAAAwACAABqAAADdwIAAGsAAAPWAQAAbAAAAwACAABtAAADgwIAAG4AAAPOAQAAbwAAAwACAABwAAADCQIAAHEAAAMWAAAAcgAAAwAAAABzAAAD6P///3QAAANy/v//dQAAA0wAAAB2AAADUgAAAHcAAAMAAAAAeAAAAwEAAAB5AAADgAAAAHoAAAPAAAAAewAAA8AAAAB8AAADAAEAAH0AAANZAAAAfgAAA04AAAB/AAAD1AEAAIAAAAMAAgAAgQAAA2YCAACCAAAD/QEAAIMAAAMAAgAAhAAAAygCAACFAAADzgEAAIYAAAMAAgAAhwAAAwkCAACIAAADAAAAAIkAAAMAAAAAigAAAwAAAACLAAADZAAAAIwAAANkAAAAjQAAA/0BAACOAAADAAIAAI8AAAMoAgAAkAAAA0ACAACRAAADAAIAAJIAAAPVAQAAkwAAA84BAACUAAADAAIAAJUAAAMJAgAAlgAAA2QAAACXAAADZAAAAJgAAANAAgAAmQAAAwACAACaAAAD1QEAAJsAAAP9AQAAnAAAAwACAACdAAADRAIAAJ4AAAPOAQAAnwAAAwACAACgAAADCQIAAKEAAAMEAAAAogAAAwAAAACjAAADWQAAAKQAAANZAAAApQAAA/gBAACmAAADAAIAAKcAAAM9AgAAqAAAAw0AAACpAAADFgAAAKoAAAMWAAAAqwAAAwAAAACsAAADBAAAAK0AAAMAAAAArgAAAwIAAACvAAADAgAAALAAAAMWAAAAsQAAA10AAACyAAADIwAAALMAAAMuAAAAtAAAAzkAAAC1AAADAQEAALYAAAMQERERtwAAA3UCAAC4AAADCwAAALkAAAMAAAAAugAAAwoAAAC7AAADMgAAALwAAANpAAAAvQAAA4cAAAC+AAADZAAAAL8AAAOCAAAAwAAAA3gAAADBAAADoAAAAMIAAAMyAAAAwwAAA2QAAADEAAADZAAAAMUAAAOCAAAAxgAAA3gAAADHAAADoAAAAMgAAAMyAAAAyQAAA2QAAADKAAADfQAAAMsAAAOlAAAAzAAAA3MAAADNAAADmwAAAM4AAAOHAAAAzwAAA6oAAADQAAADcwAAANEAAAObAAAA0gAAA2QAAADTAAADggAAANQAAANzAAAA1QAAA5EAAADWAAADMgAAANcAAANkAAAA2AAAAwAAAADZAAADAAAAANoAAANd////2wAAA/H+///cAAADZP///90AAAOj/v//3gAAA7j////fAAADnv7//+AAAAPq////4QAAA27+///iAAADQQAAAOMAAAOe/v//5AAAA7cAAADlAAAD3f7//+YAAAMsAAAA5wAAA4X+///oAAADKQMAAOkAAAObAQAA6gAAA/wCAADrAAADfQEAAOwAAAMYAgAA7QAAA+8BAADuAAADtwwAAO8AAAPl+f//8AAAAx4LAADxAAADwPf///IAAANCAQAA8wAAAxL////0AAAD2A0AAPUAAANkAgAA9gAAAy0CAAD3AAADMgAAAPgAAAORAQAA+QAAAwEAAAD6AAADrQIAAPsAAAOTAAAA/AAAA9gCAAD9AAADdQEAAP4AAAMAAAAA/wAAAwAAAAAAAQADEAIAAAEBAAP1AQAAAgEAA8gJAAADAQADMvf//wQBAAOFCgAABQEAAzL4//8GAQADAAAAAAcBAAMAAAAACAEAA9cAAAAJAQADYf///woBAAMZDQAACwEAA6UBAAAMAQADfwEAAA0BAAMyAAAADgEAAwwBAAAPAQADPgEAABABAAOwBAAAEQEAAwABAAASAQADwAEAABMBAANOAgAAFAEAA7cBAAAVAQADPgIAABYBAAPuAQAAFwEAAw4CAAAYAQADSvz//xkBAAPxAwAAGgEAA7n7//8bAQADLAMAABwBAAMA////HQEAA74AAAAeAQADUwUAAB8BAANeAQAAIAEAAz8BAAAhAQADPwEAACIBAAMBAAAAIwEAA/UAAAAkAQADYAAAACUBAAMAAAAAJgEAAwAAAAAnAQADAAAAACgBAAMAAAAAKQEAAwAAAAAqAQADAAAAACsBAAMAAAAALAEAAwAAAAAtAQADAAAAAC4BAAMAAAAALwEAAwAAAAAwAQADAAAAADEBAAMAAAAAMgEAAwAAAAAzAQADAAAAADQBAAMAAAAANQEAAwAAAAA2AQADAAAAADcBAAMAAAAAOAEAAwAAAAA5AQADAAAAADoBAAMAAAAAOwEAAwAAAAA8AQADIgAAAD0BAAMYAAAAPgEAAyIAAAA/AQADGQAAAEABAAMIAAAAQQEAAxsAAABCAQADeAAAAEMBAANaAAAARAEAAwEAAABFAQADAQAAAEYBAAMBAAAARwEAA/4AAABIAQAD/gAAAEkBAAP+AAAASgEAA0FBAQBLAQADoaAAAEwBAANBQQEATQEAA/8PAABOAQAD/w8AAE8BAAP/DwAAUAEAAxECAABRAQADCAIAAFIBAAMAAgAAUwEAAxQAAABUAQAD/gAAAFUBAAPc////VgEAAwAAAABXAQADAAAAAFgBAAMAAAAAWQEAAwAAAABaAQADe////1sBAAMc/f//XAEAA7L+//9dAQADB////14BAAN7////XwEAAxz9//9gAQADJP7//2EBAAOy/v//YgEAAxYAAABjAQADe////2QBAAOO/v//ZQEAA/7+//9mAQADEgAAAGcBAAN7////aAEAAyT+//9pAQADjv7//2oBAANuAAAAawEAAxYAAABsAQADjv7//20BAAP+/v//bgEAA7gBAABvAQADbgAAAHABAAOn/v//cQEAA/7+//9yAQADbgAAAHMBAAMSAAAAdAEAA0f+//91AQADjv7//3YBAAMAAAAAdwEAAwAAAAB4AQADAAAAAHkBAAMAAAAAegEAAwAAAAB7AQADAAAAAHwBAAMAAAAAfQEAAwAAAAB+AQADYhEAAH8BAANRAAAAgAEAA+P///+BAQADFwAAAIIBAAPN////gwEAA7b///+EAQAD5P///4UBAAO7////hgEAA9r///+HAQADxAAAAIgBAAMLAQAAiQEAA+EAAACKAQAD3f///4sBAAO8////jAEAA83///+NAQADAAAAAI4BAAPE////jwEAA+P///+QAQADEQIAAJEBAAMIAgAAkgEAAwACAACTAQADXAMAAJQBAAMAAgAAlQEAA/0CAACWAQADeQMAAJcBAAMIAgAAmAEAA/0CAACZAQADAAIAAJoBAAMAAgAAmwEAAwACAACcAQADAAIAAJ0BAAMAAgAAngEAAwACAACfAQADAAIAAKABAAMAAgAAoQEAAwACAACiAQADAAIAAKMBAAMAAgAApAEAAwACAAClAQADAAIAAKYBAAMAAgAApwEAAwACAACoAQADAAIAAKkBAAMAAgAAqgEAAwACAACrAQADAAIAAKwBAAMAAgAArQEAA/sBAACuAQADAAIAAK8BAAMAAgAAsAEAAwACAACxAQADeQMAALIBAAMAAgAAswEAA3kDAAC0AQADagMAALUBAAMAAgAAtgEAA4cDAAC3AQADAAAAALgBAAMAAAAAuQEAAwAAAAC6AQADXAMAALsBAAMAAgAAvAEAA/0CAAC9AQADAAAAAL4BAAMAAAAAvwEAA4X+///AAQADA////8EBAAP9/v//wgEAA+j+///DAQADgv///8QBAAOu/v//xQEAA6j////GAQADh/7//8cBAAMUAAAAyAEAA6D+///JAQADIwAAAMoBAAO7/v//ywEAAwAAAADMAQADAAAAAM0BAAMAAAAAzgEAAwAAAADPAQADrP7//9ABAAPQ/v//0QEAAyb////SAQADxv7//9MBAAOz////1AEAA5/+///VAQAD3v///9YBAAN+/v//1wEAA0UAAADYAQADpv7//9kBAANQAAAA2gEAA8L+///bAQADVQAAANwBAAOG/v//3QEAAwACAADeAQADAAIAAN8BAAMAAgAA4AEAAwACAADhAQADYAIAAOIBAAOVBQAA4wEAAw8CAADkAQADAAIAAOUBAAMmBAAA5gEAA6sCAADnAQADAAIAAOgBAAPAAwAA6QEAA/UCAADqAQADAAIAAOsBAAPBAwAA7AEAA08DAADtAQADAAIAAO4BAAMiAwAA7wEAA0EDAADwAQADAAIAAPEBAAP3AgAA8gEAAwACAADzAQADAAIAAPQBAAMAAgAA9QEAA/j////2AQAD/gAAAPcBAAPc////+AEAA6H////5AQADgAAAAPoBAANlAAAA+wEAAyMDAAD8AQADEgIAAP0BAAMLAwAA/gEAAzIDAAD/AQADAAIAAAACAAMCAwAAAQIAA0EDAAACAgADAAIAAAMCAAP3AgAABAIAAwIDAAAFAgADAAIAAAYCAAMCAwAABwIAAwAAAAAIAgADAAAAAAkCAAMAAAAACgIAAwAAAAALAgADe////wwCAAMc/f//DQIAAwf///8OAgADsv7//w8CAAN7////EAIAAxz9//8RAgADsv7//xICAAMk/v//EwIAAxYAAAAUAgADe////xUCAAP+/v//FgIAA47+//8XAgADEgAAABgCAAN7////GQIAA47+//8aAgADJP7//xsCAANuAAAAHAIAAxYAAAAdAgAD/v7//x4CAAOO/v//HwIAA7gBAAAgAgADbgAAACECAAP+/v//IgIAA6f+//8jAgADbgAAACQCAAMSAAAAJQIAA47+//8mAgADR/7//ycCAAO4AQAAKAIAAxz9//8pAgADIP///yoCAAMk/v//KwIAA4cAAAAsAgADFgAAAC0CAAP+/v//LgIAA47+//8vAgAD6wAAADACAAM8AAAAMQIAA/7+//8yAgADjv7//zMCAANPAQAANAIAAzwAAAA1AgAD/v7//zYCAAOO/v//NwIAAxYAAAA4AgADdv///zkCAAP+/v//OgIAA47+//87AgADggAAADwCAANP////PQIAA/T+//8+AgADTP7//z8CAAOK////QAIAA8L+//9BAgAD9P7//0ICAANM/v//QwIAA4r///9EAgADwv7//0UCAAP+/v//RgIAA47+//9HAgADmAMAAEgCAAMAAgAASQIAA6gCAABKAgAD3gMAAEsCAAMAAgAATAIAA7oCAABNAgAD4QMAAE4CAAMAAgAATwIAA5MCAABQAgADoAIAAFECAAMAAgAAUgIAA3QDAABTAgADKgMAAFQCAAMAAgAAVQIAA9QDAABWAgADJgIAAFcCAAMAAgAAWAIAA2YEAABZAgADAAIAAFoCAAMAAgAAWwIAAyYEAABcAgADMgAAAF0CAAN0CwAAXgIAAzIAAABfAgADdAsAAGACAAMyAAAAYQIAA/UDAABiAgADaQAAAGMCAAOm/v//ZAIAA2kAAABlAgADpv7//2YCAAN7////ZwIAA5v+//9oAgADe////2kCAAOU/v//agIAA3v///9rAgADev7//2wCAAN7////bQIAA2D+//9uAgADmP7//28CAAONAAAAcAIAA5j+//9xAgADjQAAAHICAAMAAAAAcwIAAwEAAAB0AgADBgAAAHUCAANzAAAAdgIAA5sAAAB3AgADZAAAAHgCAANBAAAAeQIAA5oBAAB6AgADmgEAAHsCAAMBAAAAfAIAA3gAAAB9AgADggAAAH4CAAMKAAAAfwIAAwAAAACAAgADqwAAAIECAAMBAAAAggIAAzIAAACDAgADRgAAAIQCAAOAAAAAhQIAAwEAAACGAgADMgAAAIcCAANGAAAAiAIAA8AAAACJAgADAAAAAIoCAAMAAQAAiwIAA2QAAACMAgADZAAAAI0CAANGAAAAjgIAAx4AAACPAgADZAAAAJACAANkAAAAkQIAA2QAAACSAgADZAAAAJMCAANkAAAAlAIAA2QAAACVAgADSwAAAJYCAAMyAAAAlwIAA2QAAACYAgADXwAAAJkCAANLAAAAmgIAAzIAAACbAgADWgAAAJwCAANQAAAAnQIAAzcAAACeAgADHgAAAJ8CAANkAAAAoAIAA2QAAAChAgADZAAAAKICAANkAAAAowIAA2QAAACkAgADZAAAAKUCAANkAAAApgIAA0sAAACnAgADWgAAAKgCAANQAAAAqQIAAzcAAACqAgADHgAAAKsCAAP8CAAArAIAAyILAACtAgADpg4AAK4CAAPsEwAArwIAA2QZAACwAgADXP7//7ECAAPW/v//sgIAA2P///+zAgAD9f///7QCAAMAAAAAtQIAA8kAAAC2AgADlgMAALcCAAMAAgAAuAIAA2QDAAC5AgADXwIAALoCAAMAAgAAuwIAA2wEAAC8AgADWAAAAL0CAANwAwAAvgIAAwACAAC/AgADgwMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAAAAABAAAEAAAAAAIAAAQAAAAAAwAABAAAAAAEAAAEK3UAAAUAAASAAAAABgAABB4FAAAHAAAEAAQAAAgAAAQHAAAACQAABAAAAAAKAAAEAgAAAAsAAAQBAAAADAAABAAAAAANAAAEZAAAAA4AAAQAAAAADwAABJcOAAAQAAAEAAAAABEAAAQxGmYSEgAABNB+/QkTAAAEMRpmEhQAAAQzG2YSFQAABIMcZhIWAAAEQEIPABcAAAQAAAAAGAAABECcAAAZAAAEAAAAABoAAAQAAAAAGwAABAAAAAAcAAAEAAAAAB0AAAQAAAAAHgAABAAAAAAfAAAEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABgEAAAABAAAGAwAAAAIAAAYAAAAAAwAABgEAAAAEAAAGAQAAAAUAAAYAAFADAAAAAAAAAAAHAAAGAQAAAAgAAAYAAAAwCQAABoDwAAAKAAAGSPAAAAsAAAZIAIAADAAABiAgICANAAAGAAAAAA4AAAYBAAAADwAABhkAAAAQAAAGHwAAABEAAAZ9AQAAEgAABoAAAAATAAAG7f///xQAAAYrAAAAFQAABiwAAAAWAAAGnP///xcAAAb3////GAAABiAAAAAZAAAGhwAAABoAAAZuAAAAGwAABiwBAAAcAAAGmf///x0AAAYrAAAAHgAABqv///8fAAAGnv///yAAAAb2////IQAABmMBAAAiAAAGFgAAACMAAAbu////JAAABgEAAAAlAAAGAQAAACYAAAb/////JwAABv////8oAAAGBgAAACkAAAYNAAAAKgAABvz///8rAAAGBAAAACwAAAb1////LQAABgsAAAAuAAAGAAAAAC8AAAb+////MAAABvT///8xAAAGyAEAADIAAAYuAAAAMwAABvz///80AAAG/////zUAAAYDAAAANgAABgIAAAA3AAAG9v///zgAAAYAAAAAOQAABuz///86AAAGAAAAADsAAAb4////PAAABg4AAAA9AAAGEAAAAD4AAAb+////PwAABgMAAABAAAAG+////0EAAAZjAQAAQgAABhYAAABDAAAG7v///0QAAAYBAAAARQAABgEAAABGAAAG/////0cAAAb/////SAAABgYAAABJAAAGDQAAAEoAAAb8////SwAABgQAAABMAAAG9f///00AAAYLAAAATgAABgAAAABPAAAG/v///1AAAAb0////UQAABmMBAABSAAAGFgAAAFMAAAbu////VAAABgEAAABVAAAGAQAAAFYAAAb/////VwAABv////9YAAAGBgAAAFkAAAYNAAAAWgAABvz///9bAAAGBAAAAFwAAAb1////XQAABgsAAABeAAAGAAAAAF8AAAb+////YAAABvT///9hAAAGYwEAAGIAAAYWAAAAYwAABu7///9kAAAGAQAAAGUAAAYBAAAAZgAABv////9nAAAG/////2gAAAYGAAAAaQAABg0AAABqAAAG/P///2sAAAYEAAAAbAAABvX///9tAAAGCwAAAG4AAAYAAAAAbwAABv7///9wAAAG9P///3EAAAZbAAAAcgAABqIRAABzAAAGQgMAAHQAAAYAAgAAdQAABmEDAAB2AAAGOAAAAHcAAAbW////eAAABu0DAAB5AAAGUgAAAHoAAAYmAAAAewAABgAAAAB8AAAGBAAAAH0AAAYAAAAAfgAABgAAAAB/AAAGAAAAAIAAAAYAAAAAgQAABgAAAACCAAAGEAAAAIMAAAYHAAAAhAAABgEAAACFAAAGAAAAAIYAAAYAAAAAhwAABgAAAACIAAAGAAAAAIkAAAYAAAAAigAABswQAACLAAAGwBIAAIwAAAZuAAAAjQAABocAAACOAAAGzv///48AAAYyAAAAkAAABgABAACRAAAGAAIAAJIAAAYsAQAAkwAABvQBAACUAAAGUAAAAJUAAAZ4AAAAlgAABngAAACXAAAG3AAAAJgAAAZuAAAAmQAABpYAAACaAAAGAAAAAJsAAAYAAAAAnAAABgAAAACdAAAGAAAAAJ4AAAYAAAAAnwAABgAAAACgAAAGAAAAAKEAAAYAAAAAogAABgAAAACjAAAGAAAAAKQAAAYAAAAApQAABgAAAACmAAAGAAAAAKcAAAYAAAAAqAAABgAAAACpAAAGAAAAAKoAAAYAAAAAqwAABgAAAACsAAAGAAAAAK0AAAYAAAAArgAABgAAAACvAAAGAAAAALAAAAYAAAAAsQAABgAAAACyAAAGAAAAALMAAAYAAAAAtAAABgAAAAC1AAAGAAAAALYAAAYAAAAAtwAABgAAAAC4AAAGAAAAALkAAAYAAAAAugAABjYAAAC7AAAGNgAAALwAAAaEAwAAvQAABg8AAAC+AAAGCAAAAL8AAAYZAAAAwAAABgoAAADBAAAGOwEAAMIAAAYQAAAAwwAABvT////EAAAG+f///8UAAAYAAAAAxgAABgYAAADHAAAG/////8gAAAb+////yQAABtADAADKAAAGnW0AAMsAAAZgmQEAzAAABn2rAQDNAAAG0mUCAM4AAAYcxwIAzwAABhzHAgDQAAAGHMcCANEAAAYfAAAA0gAABu/////TAAAG+P///9QAAAYQAAAA1QAABv3////WAAAG/P///9cAAAYFAAAA2AAABvz////ZAAAGKSMAANoAAAZZmwAA2wAABhzHAgDcAAAG+xoBAN0AAAaBAwEA3gAABhzHAgDfAAAGHMcCAOAAAAYcxwIA4QAABvIAAADiAAAGGwAAAOMAAAb7////5AAABv7////lAAAG+////+YAAAYDAAAA5wAABvr////oAAAG/////+kAAAbp////6gAABu/////rAAAG9v///+wAAAYUAAAA7QAABv3////uAAAG/f///+8AAAYHAAAA8AAABvz////xAAAGNAQAAPIAAAZUAAAA8wAABiEAAAD0AAAGLAAAAPUAAAYbAAAA9gAABiEAAAD3AAAGDAAAAPgAAAYLAAAA+QAABkL+///6AAAGuv////sAAAbO/////AAABt3////9AAAG2v////4AAAbw/////wAABuP///8AAQAG7P///wEBAAZsAQAAAgEABhwAAAADAQAGDwAAAAQBAAY4AAAABQEABicAAAAGAQAGEAAAAAcBAAYYAAAACAEABgUAAAAJAQAG0/7//woBAAab////CwEABuL///8MAQAG3P///w0BAAbK////DgEABub///8PAQAG/P///xABAAbn////EQEABmkAAAASAQAGGwAAABMBAAb8////FAEABvv///8VAQAG/f///xYBAAYEAAAAFwEABvr///8YAQAG/v///xkBAAbm////GgEABvH///8bAQAG9f///xwBAAYRAAAAHQEABgAAAAAeAQAG/v///x8BAAYHAAAAIAEABvz///8hAQAGAAAAACIBAAYAAAAAIwEABgAAAAAkAQAGAAAAACUBAAYAAAAAJgEABgAAAAAnAQAGAAAAACgBAAYAAAAAKQEABgEAAAAqAQAGBQAAACsBAAYBAAAALAEABgAAAAAtAQAGAgAAAC4BAAYyAwAALwEABgACAAAwAQAGAgMAADEBAAZ5AwAAMgEABgACAAAzAQAGeQMAADQBAAZqAwAANQEABgACAAA2AQAGhwMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAkDEAAAEAAAAAAAAAGAAAABIAAAAAEAAAAAkAAAgAAAAbAAAAqgAAAH0AAAAjAgAATwMAAHgEAAAUBQAAKAUAAMsDAACAAwAAxgEAAB0BAAAEAQAA9wAAAPIAAAAIAQAABwEAAOwAAAAhAQAAGQEAAIkAAACHAAAA3QAAACwBAAD5AAAAUwQAAF0DAAAAAAAAawIAADYEAADlAwAA4AQAADoEAADyAwAAAgUAAPgBAACcAAAAtgAAALwAAAC5AAAA+gAAAKYAAACpAAAA6wAAANEAAAAEAQAA7wAAAN0AAAAKAQAAywAAAL8EAAAdBAAAAAAAAC8AAADdBAAAQgQAADYFAABPAwAAiwIAAAAAAAC2AQAAwgEAAB4AAAAUAAAADwAAAG0AAABNAQAA0AEAAA4BAADCAAAA0wAAAMsAAADUAAAA9gAAANcAAACOBQAABAQAAAAAAAAAAAAAEwUAANcCAAAjAQAAGgEAAG4BAAA0AQAAXgEAABABAABSAQAAFgAAAMYAAAAvAAAA2AEAABABAAAJAAAAGQAAAAgAAACfAAAA2wAAAO0AAACEAAAAEAYAAEcDAAAAAAAAAAAAAPMDAAAHAAAAlAEAAOQAAAAeAAAA1wEAAIwBAABwAAAAkgEAAAMAAAA7AgAAhgAAAAMBAAAAAAAAAAAAAAAAAAAAAAAAmwAAAKsAAADiAAAAzwAAAAMHAABvAwAAAAAAAEUAAADCAwAAEQAAAKMAAACUAQAAhAAAABMBAAC/AAAAAAAAABIAAADnAAAAAAAAAAAAAADaAAAArAAAABsAAAAQAAAAAAAAAJoAAACBAAAAsgAAAAAAAAAzBwAACgQAAAAAAACMAAAA1wEAAGEAAADrAAAAzQIAAMUAAADTAAAACgEAAJgAAADCAAAAFgEAAAMDAAC9AAAAmQAAAAAAAAAFAAAAAAAAAAAAAACUAAAAMAEAAGUAAAAAAAAARwcAAFUEAAAAAAAA4gAAAAgCAABbAAAAMQAAAEAAAAAlAAAAAAAAAAsAAACQAAAAFgEAALcBAAAFAAAAFQAAAJEAAAAGAAAAWAAAAAYBAAAeAQAAWQIAANQCAAAkAAAALAAAAH4HAAAzBQAAAAAAAA0BAABwAQAAUgAAAMMAAAAfAwAA5wEAAC4AAADcAAAAgwAAAO8AAAB0AgAAAAAAACoAAAAPAAAACwAAAG8BAAAlAgAA9QIAAIEFAADEBQAAbAAAABEAAADuBwAAVgQAAAAAAADzAAAALAEAAF8AAAA6AAAAZgAAAG4AAAAmAAAAGQAAAEMAAACOAgAAdQIAAPoCAAAaAAAAIAAAAO8AAAAAAAAASAAAAIYAAAALAAAANQAAAJ4AAAAAAAAAKQcAABUEAAAAAAAAIgEAAIEBAAB5AAAAhAAAAGIAAAAPAAAALQAAAKgAAAB0AAAAKAMAAAAAAADfBQAAlgEAACAAAAClAQAAEAAAAGYAAACwAAAACgAAAE0AAABTAAAAAAAAAEYGAAB3AwAAAAAAAN8CAAAsAwAA2QAAAJcCAABiAAAAJQAAADAAAAD5AAAAjgAAAEoAAAAAAAAAAAAAAF0BAAACAAAABgAAAAAAAABaAAAAygAAAA4AAAAvAAAACgAAAK4DAABhBQAAfAIAAAAAAADvAAAAZgAAAGYAAAAhAAAAqAAAAHQAAABpAAAAfwAAAE8AAAABAQAApwIAABoBAAAAAAAAAAAAAAAAAAAAAAAALQAAAKQAAAD6AAAAMgAAAH8AAABVAgAAkgIAALgBAAAAAAAAeQMAAFgCAABOAAAAKAAAAIcAAACOAAAAPgEAAHUAAABPAwAAxwEAAHABAACrAQAAAAAAAAAAAACfAAAAAAAAALoAAABHAAAAcwEAAOABAAAfAgAArgEAAKMCAAAgAgAAAAAAAPwDAAACBAAAPAAAADgAAAAAAAAAzQEAAPIAAAB+AAAAEAAAACUAAAA7AAAAmQAAAIUBAABFAAAAtQAAAAAAAAADAQAATgEAANQBAAA6AgAAzgIAAJ4DAADiAwAAhgMAAAAAAADWAwAAZgMAACsAAAAdAAAAxAEAABEDAAA5AAAAIQAAAOUAAAAdAAAAGgAAACIAAADrAAAANQAAABcBAAA+AQAA8wAAAFQBAABUAgAA+AIAAKMDAAD0AgAAAAAAAOcDAAAAAAAAGQMAAKgCAABDAAAAVwIAAH0DAABSAwAATgIAAEMAAADgAAAAAAAAAEkBAAAJAAAAswEAAJQBAAA0AgAAmQEAAGUCAADHAgAAOAMAAEQCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAOABAACeAgAAbAIAAIwDAADmAwAAwwMAAGsDAABhAgAAIgIAAAAAAADXAAAACgEAAG0BAAAZAgAAUQIAAN4CAABHAwAAdgIAAAAAAAAAAAAAAAAAAAAAAAD2AAAAQwEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIAQAAGUFAAB4BwAAiQgAAH0IAABFBgAAwwUAAPoCAAD6AQAA0AEAALUBAACnAQAAzgEAAM0BAACgAQAA+AEAANsBAAALAQAABQEAALcBAABPAgAA2gEAANUGAACHBQAAAAAAAKgEAADbBgAAfAYAACwIAAD0BgAAjwYAAFAIAABEAwAAFQEAAEYBAABNAQAARAEAALMBAAAiAQAAJQEAAJcBAABpAQAAAAIAAM8BAAC7AQAAFwIAAI8BAACLBwAAnAYAAAAAAABaAAAA8QcAABMHAACpCAAAjAUAAEUEAAAAAAAA2QIAAEECAAA4AAAAJQAAABwAAAC/AAAA2wEAACcCAADUAQAAUAEAAJ4BAACMAQAAqQEAAOkBAAChAQAAxAgAAHAGAAAAAAAAAAAAAEAIAACyBAAAjgEAAFQBAADfAQAAmwEAANoBAABTAQAAuwEAACIAAAAHAQAALwAAAGkCAABnAQAAEAAAAC0AAAARAAAALQEAALABAADTAQAA+gAAAJYJAAA/BQAAAAAAAAAAAABuBgAACQAAAKMBAADIAAAAIgAAADEBAAD6AQAAjgAAAP8BAAAEAAAAnwIAANsAAACYAQAAAAAAAAAAAAAAAAAAAAAAACkBAABZAQAAtQEAAIcBAAD8CgAAdQUAAAAAAACrAAAAGwYAAB4AAAClAAAAMQEAAJYAAACwAAAAgAAAAAAAAAAaAAAAVAEAAAAAAAAAAAAAWgEAAAIBAAAxAAAAHQAAAAAAAAAmAQAA+QAAAFIBAAAAAAAANgsAAHIGAAAAAAAAVgEAAEcDAAC6AAAA4gAAAP0BAACyAAAAnwAAAMoAAADoAAAAJwEAAK0BAACsBAAAHwEAAPIAAAAAAAAACQAAAAAAAAAAAAAAHQEAAPcBAAC2AAAAAAAAAFULAADcBgAAAAAAAEgCAACcAwAApwAAADAAAABFAAAAHAAAAAAAAAATAAAA3wAAAJ0BAABPAgAACgAAACMAAADhAAAACwAAAJEAAABZAQAATAIAAKEDAABmBAAAQwAAAFEAAACmCwAAGwgAAAAAAACWAgAA0wIAAJkAAAC7AAAAcQIAAMYBAABSAAAAZQEAAKgAAABkAQAAPgMAAAAAAAA/AAAAHQAAAA0AAACRAQAAmgMAAOcEAAB4CAAAzwgAAMoAAAAgAAAAXgwAAMoGAAAAAAAAbAIAAGYCAACpAAAAaQAAAKgAAAC1AAAAQgAAAC0AAAB+AAAAUwQAAF8DAABHBAAAJwAAADAAAAAxAQAAAAAAAIsAAAABAQAAFQAAAGgAAAAdAQAAAAAAABgLAABRBgAAAAAAAAEDAADzAgAA3AAAAPQAAAC0AAAAHgAAAFEAAABRAQAA4QAAAMEEAAAAAAAAyAgAAFkCAAAwAAAAEgIAAB4AAAC4AAAATAEAABIAAACOAAAAmQAAAAAAAACxCQAAQwUAAAAAAADrBAAAXQUAAJIBAABSBAAAtQAAAEYAAABfAAAA5wEAABkBAACHAAAAAAAAAAAAAABMAgAABAAAAAgAAAAAAAAAowAAAIQBAAAbAAAAWAAAABIAAACNBQAATggAALgDAAAAAAAAtwEAAL0AAADDAAAAPQAAAB0BAADEAAAAzwAAAAABAAClAAAAvwEAAAMEAACuAQAAAAAAAAAAAAAAAAAAAAAAAFUAAAA8AQAAdwEAAFYAAADeAAAAhQMAAPQDAACFAgAAAAAAABMGAAAFBAAAkwAAAEgAAAD4AAAAAwEAAJoCAADrAAAAiQQAAGcDAAAoAgAAiwIAAAAAAAAAAAAACgEAAAAAAAATAQAAjQAAACMCAADJAgAAJQMAAH4CAADsAwAA/wIAAAAAAAD1BgAA2gYAAG0AAABmAAAAAAAAAP0CAAAGAgAADAEAAB4AAABJAAAAcAAAAC4BAAD8AgAAgwAAACwBAAAAAAAAhwEAAPgBAAC1AgAAVQMAAC8EAABbBQAAvwUAAPoEAAAAAAAAqAYAANYFAABUAAAANQAAAPoCAAAoBQAAdwAAAEQAAADSAQAAOwAAADEAAABAAAAA2QEAAFsAAACuAQAAnQEAAGsBAAD5AQAAeQMAAH4EAAB3BQAAeAQAAAAAAABHBgAAAAAAAFkFAACaBAAAfgAAANUDAAC+BQAAhQUAAOkDAAB/AAAAwAEAAAAAAAArAgAAEgAAAJYCAABXAgAAUwMAAF8CAACZAwAALwQAANwEAABnAwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAqAwAAawQAAAEEAADiBQAAfQYAAEYGAADGBQAAFwQAALEDAAAAAAAARgEAAKEBAAAoAgAAIwMAAHADAAA7BAAAAQUAAM0DAAAAAAAAAAAAAAAAAAAAAAAArwAAAAkBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAMACAABCAwAAkAQAACwFAAAhBQAAvgMAAG0DAADCAQAAKAEAAA4BAAD6AAAA8QAAAAMBAAADAQAA6AAAABoBAAAJAQAA0QAAAMsAAABbAQAA0wEAAGUBAAC3AwAAFAMAAAAAAAAtAwAAJQQAAPUDAAD0BAAAMwQAAO0DAADyBAAA7gEAAKEAAAC9AAAAvgAAALgAAAD1AAAApAAAAKMAAADjAAAAzQAAAI0BAABkAQAAZgEAAKQBAAAxAQAAFgQAAJgDAAAAAAAAPQAAANAEAABNBAAANQUAAFQDAACMAgAAAAAAALABAAA3AQAAHgAAABQAAAAPAAAAbgAAAPEAAAAOAQAAAwEAAMAAAABBAQAAMAEAAFUBAACFAQAAOQEAAL0EAACEAwAAAAAAAAAAAAAABQAA4AIAAOkAAADBAAAAEAEAAOUAAAAIAQAAtwAAAOkAAAATAAAAkAAAABoAAABFAQAAwwAAAAgAAAAbAAAADQAAAOkAAABdAQAAbwEAAKcAAAAvBQAA2AIAAAAAAAAAAAAAAwQAAAYAAADfAAAAdAAAABUAAAC2AAAACAEAAE8AAAAJAQAAAwAAAEYBAAB/AAAA4QAAAAAAAAAAAAAAAAAAAAAAAADiAAAAFgEAAFQBAAAdAQAA7QUAAPICAAAAAAAAxgAAABMEAAAWAAAAaAAAALAAAABcAAAAZAAAAEcAAAAAAAAAEQAAALQAAAAAAAAAAAAAAL0AAACJAAAAIAAAABMAAAAAAAAA4gAAAMAAAAD8AAAAAAAAAAAGAAB4AwAAAAAAAIYBAABnAgAAkAAAAIwAAAAkAQAAawAAAFwAAABzAAAAewAAAJoAAADoAAAAlAIAAJcAAACGAAAAAAAAAAYAAAAAAAAAAAAAAN0AAADLAAAAZwAAAAAAAAAHBgAAqwMAAAAAAACzAgAApwIAAH4AAAAhAAAALgAAABEAAAAAAAAAEQAAAHgAAADVAAAARgEAAAcAAAAWAAAAewAAAAcAAABfAAAAwQAAAO4BAADpAQAASgIAAC4AAAA2AAAAOQYAAEkEAAAAAAAA8QIAAD0CAABzAAAAfgAAAI8BAAA6AQAANwAAANsAAABnAAAAugAAAMYBAAAAAAAAKgAAABAAAAAIAAAA2QAAACkCAADeAgAAYQQAAI8EAACHAAAAFgAAAKEGAACYAwAAAAAAANMCAAAEAgAAfAAAAEsAAABuAAAAdwAAACwAAAAeAAAAVQAAAJYCAADTAQAANwIAABoAAAAgAAAAowAAAAAAAABdAAAArQAAAAwAAABHAAAAzgAAAAAAAADwBQAATwMAAAAAAACHAwAAQQIAAJ0AAACwAAAAdgAAABIAAAA2AAAA6QAAAJoAAACUAgAAAAAAAKcEAAA2AQAAIAAAABwBAAAUAAAAgQAAANwAAAANAAAAagAAAGgAAAAAAAAANgUAALkCAAAAAAAASAMAAIUDAAAhAQAAuwIAAHgAAAAtAAAAQwAAAEkBAADCAAAAWAAAAAAAAAAAAAAATwEAAAIAAAAGAAAAAAAAAHQAAAAAAQAAEgAAADwAAAAMAAAA8gIAAIIEAADqAQAAAAAAACYBAACAAAAAlQAAACkAAAC6AAAAgQAAAJIAAACzAAAAeAAAACUBAAAvAgAA6wAAAAAAAAAAAAAAAAAAAAAAAAA4AAAA1AAAAMMAAABCAAAAngAAAOIBAAAtAgAATQEAAAAAAADeAwAAhwIAAHAAAAAwAAAApgAAAKoAAADsAQAAnwAAAHICAABWAgAALQEAAGABAAAAAAAAAAAAAJUAAAAAAAAAkQAAAGAAAAAcAQAAdQEAAKgBAABOAQAADwIAAIABAAAAAAAAcAQAAFAEAABSAAAARAAAAAAAAADIAQAAggEAAMMAAAAVAAAAMwAAAEsAAADOAAAAEgIAAFgAAACtAAAAAAAAANEAAAAKAQAAagEAAMABAAAxAgAA0AIAAAgDAAB6AgAAAAAAADkEAACuAwAAOQAAACMAAADLAQAACwMAAFYAAAAvAAAATwEAACkAAAAfAAAAKgAAAE8BAABJAAAA6QAAANgAAAC9AAAACgEAANEBAABhAgAA6AIAAGYCAAAAAAAAnQMAAAAAAABmAwAA9AIAAFQAAAA/AgAAWgMAADcDAABOAgAAXwAAAEABAAAAAAAAQQEAAAwAAABmAQAAPQEAAMgBAAA9AQAA5AEAADQCAACOAgAA0AEAAAAAAAAAAAAAAAAAAAAAAAAAAAAA9wEAAL4CAABVAgAAcQMAAM8DAACoAwAAZgMAAHACAAA1AgAAAAAAAK0AAADmAAAAIwEAAKgBAADHAQAANAIAAK8CAAAJAgAAAAAAAAAAAAAAAAAAAAAAAGQAAACXAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAASAAAADgAAAA8AAAARAAAAEgAAAA4AAAAOAAAAEQAAABkAAAAZAAAAGAAAABcAAAAXAAAAFgAAABQAAAAXAAAADwAAAAwAAAANAAAAFAAAABkAAAAQAAAADwAAAA0AAAAAAAAAEwAAABIAAAANAAAAEAAAAA8AAAAQAAAAFgAAABMAAAAQAAAAFAAAABQAAAATAAAAGAAAAA8AAAAOAAAAEwAAAA4AAAAYAAAAGAAAABYAAAAXAAAADgAAABEAAAAQAAAAAAAAAAIAAAAUAAAADgAAABEAAAANAAAADQAAAAAAAAANAAAAEwAAAAQAAAADAAAAAgAAAAwAAAAOAAAADAAAABYAAAAMAAAAFQAAABYAAAAWAAAAFgAAAA4AAAAUAAAAEAAAAAAAAAAAAAAAFAAAAA4AAAANAAAADAAAAA0AAAAQAAAADgAAABIAAAANAAAAAwAAAA0AAAAEAAAADgAAAAwAAAABAAAAAgAAAAEAAAAUAAAAGAAAABYAAAAGAAAAFgAAAA4AAAAAAAAAAAAAABEAAAABAAAADAAAAA8AAAAEAAAAEgAAAAwAAAAMAAAADQAAAAEAAAAOAAAADQAAABEAAAAAAAAAAAAAAAAAAAAAAAAAFgAAABUAAAAXAAAADAAAABkAAAAPAAAAAAAAAAUAAAATAAAAAgAAABIAAAAVAAAACAAAAA0AAAALAAAAAAAAAAYAAAAMAAAAAAAAAAAAAAAPAAAADgAAAAUAAAACAAAAAAAAABMAAAATAAAAEwAAAAAAAAAZAAAAEgAAAAAAAAALAAAAEAAAABAAAAASAAAAGAAAAAYAAAAOAAAAEgAAABEAAAATAAAADwAAABEAAAAQAAAAEAAAAAAAAAABAAAAAAAAAAAAAAANAAAAEQAAAAkAAAAAAAAAGQAAABQAAAAAAAAADgAAABMAAAATAAAABAAAAAYAAAABAAAAAAAAAAEAAAAPAAAAFAAAAA0AAAABAAAABwAAABEAAAABAAAADQAAAAwAAAASAAAADgAAAA4AAAAEAAAAAgAAABkAAAAZAAAAAAAAABcAAAAVAAAADAAAAA4AAAAZAAAADAAAAAUAAAAMAAAABAAAABMAAAAMAAAAAAAAABAAAAAGAAAAAQAAAA0AAAAMAAAADAAAABgAAAAXAAAACAAAAAEAAAAZAAAAFAAAAAAAAAAYAAAAEQAAAA0AAAAMAAAADgAAAA0AAAAEAAAABQAAAAoAAAARAAAADAAAABAAAAAMAAAADwAAAAwAAAAAAAAADAAAABAAAAADAAAACAAAAA4AAAAAAAAAGQAAABQAAAAAAAAAFgAAAA4AAAAMAAAADAAAAAwAAAADAAAABgAAABQAAAAKAAAADQAAAAAAAAAYAAAADAAAAA0AAAAPAAAAAgAAAAsAAAARAAAAAwAAAAwAAAAGAAAAAAAAABkAAAASAAAAAAAAABMAAAAUAAAAEgAAABMAAAAKAAAABwAAAAQAAAASAAAADAAAAAIAAAAAAAAAAAAAAA0AAAABAAAAAgAAAAAAAAAIAAAAEAAAAAQAAAAIAAAAAQAAABEAAAAYAAAADwAAAAAAAAAOAAAABwAAAA8AAAAEAAAADAAAAAwAAAAGAAAACQAAAAkAAAAFAAAAEwAAAA0AAAAAAAAAAAAAAAAAAAAAAAAACAAAAAwAAAASAAAAAwAAAAwAAAAPAAAADwAAAA4AAAAAAAAAFQAAAA4AAAAQAAAAAgAAAAUAAAAGAAAADAAAAAkAAAANAAAACQAAAA0AAAAPAAAAAAAAAAAAAAAQAAAAAAAAAAwAAAAGAAAAFAAAABgAAAAXAAAADwAAABYAAAAVAAAAAAAAABcAAAAXAAAADAAAAAIAAAAAAAAADgAAAAwAAAAJAAAAAQAAAAMAAAALAAAAFQAAABUAAAACAAAADAAAAAAAAAAVAAAAFgAAABcAAAAYAAAAGQAAABkAAAAZAAAAGQAAAAAAAAAXAAAAFAAAAAcAAAAGAAAADQAAABcAAAAJAAAACQAAAAsAAAABAAAABQAAAAkAAAAVAAAAAgAAAA0AAAAMAAAADwAAABQAAAAYAAAAGQAAABkAAAAQAAAAAAAAAA8AAAAAAAAAFwAAABQAAAAJAAAAEgAAABgAAAAZAAAAFgAAAA0AAAAOAAAAAAAAABMAAAADAAAAFAAAABQAAAAXAAAAFAAAABgAAAAZAAAAGQAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA4AAAASAAAAEwAAABgAAAAZAAAAGQAAABkAAAAXAAAAFwAAAAAAAAAOAAAAEAAAABUAAAAYAAAAGQAAABkAAAAZAAAAEQAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAUAAAAFAAAABwAAAAUAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAGAAAABgAAAAYAAAAGAAAABgAAAAQAAAAHAAAAAAAAAAgAAAAFAAAABQAAAAcAAAAFAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAHAAAABgAAAAYAAAAGAAAABgAAAAYAAAAEAAAABAAAAAAAAAAIAAAABQAAAAUAAAAHAAAABwAAAAcAAAAIAAAABwAAAAMAAAAIAAAACAAAAAgAAAAHAAAABAAAAAIAAAAHAAAABwAAAAYAAAAGAAAABgAAAAYAAAAGAAAABAAAAAQAAAAAAAAACAAAAAUAAAAFAAAAAwAAAAMAAAADAAAAAwAAAAMAAAADAAAAAwAAAAgAAAADAAAACAAAAAMAAAADAAAACAAAAAgAAAAIAAAABgAAAAYAAAAGAAAACAAAAAQAAAAEAAAAAAAAAAgAAAAFAAAACAAAAAEAAAAIAAAACAAAAAgAAAADAAAAAwAAAAMAAAAIAAAAAgAAAAcAAAAEAAAACAAAAAgAAAAIAAAACAAAAAYAAAAGAAAABgAAAAYAAAAEAAAABAAAAAAAAAAIAAAABQAAAAgAAAAIAAAACAAAAAgAAAAIAAAACAAAAAgAAAAIAAAABAAAAAgAAAAIAAAABAAAAAQAAAAIAAAACAAAAAgAAAAGAAAABgAAAAYAAAAIAAAABAAAAAQAAAAAAAAACAAAAAYAAAAGAAAACAAAAAgAAAAIAAAACAAAAAgAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAIAAAACAAAAAgAAAAIAAAABgAAAAgAAAAIAAAACAAAAAQAAAAEAAAAAAAAAAgAAAAGAAAABgAAAAgAAAAIAAAACAAAAAgAAAAIAAAABAAAAAQAAAADAAAACAAAAAgAAAAEAAAACAAAAAUAAAADAAAABgAAAAQAAAAEAAAACAAAAAgAAAAEAAAABAAAAAAAAAAIAAAABgAAAAYAAAAIAAAACAAAAAgAAAAIAAAABQAAAAgAAAAEAAAAAwAAAAgAAAAFAAAACAAAAAgAAAABAAAABwAAAAcAAAAEAAAABAAAAAgAAAAIAAAABAAAAAQAAAAAAAAACAAAAAYAAAAGAAAACAAAAAUAAAAFAAAACAAAAAgAAAAIAAAABwAAAAMAAAAEAAAABQAAAAUAAAADAAAACAAAAAgAAAAIAAAACAAAAAgAAAAGAAAACAAAAAQAAAAEAAAAAAAAAAgAAAAGAAAABgAAAAYAAAAIAAAACAAAAAgAAAAIAAAACAAAAAQAAAAIAAAABAAAAAQAAAAFAAAAAwAAAAgAAAAIAAAACAAAAAgAAAAGAAAACAAAAAgAAAAEAAAABAAAAAAAAAAFAAAABQAAAAYAAAAFAAAACAAAAAgAAAAIAAAACAAAAAgAAAAIAAAACAAAAAgAAAAHAAAACAAAAAgAAAAIAAAACAAAAAgAAAAIAAAACAAAAAgAAAAEAAAABAAAAAQAAAAAAAAACAAAAAgAAAAGAAAACAAAAAUAAAAFAAAACAAAAAgAAAAIAAAACAAAAAQAAAAEAAAACAAAAAgAAAAIAAAACAAAAAgAAAAIAAAABAAAAAgAAAAGAAAABAAAAAQAAAAEAAAAAAAAAAUAAAAFAAAABgAAAAgAAAAIAAAACAAAAAgAAAAIAAAAAwAAAAgAAAAEAAAABAAAAAgAAAAIAAAABwAAAAgAAAAEAAAACAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAAAAAAFAAAABQAAAAYAAAAIAAAACAAAAAcAAAAIAAAACAAAAAgAAAAIAAAACAAAAAgAAAAIAAAACAAAAAcAAAAIAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAAAAAABQAAAAUAAAAIAAAACAAAAAcAAAAHAAAACAAAAAgAAAAIAAAACAAAAAgAAAAIAAAACAAAAAgAAAAEAAAAAwAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAgAAAAHAAAAAAAAAAUAAAAFAAAACAAAAAcAAAAHAAAABwAAAAcAAAAGAAAACAAAAAgAAAAHAAAACAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAACAAAAAgAAAAIAAAACAAAAAAAAAAFAAAABQAAAAcAAAAHAAAABwAAAAcAAAAHAAAABwAAAAcAAAAIAAAABAAAAAQAAAAEAAAABAAAAAQAAAAEAAAABAAAAAQAAAAIAAAACAAAAAgAAAAIAAAACAAAAAgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFAAAADC/v///gAAANz///8AAAAAAAAAAAAAAAAAAAAAe////xz9//8H////sv7//3v///8c/f//sv7//yT+//8WAAAAe/////7+//+O/v//EgAAAHv///+O/v//JP7//24AAAAWAAAA/v7//47+//+4AQAAbgAAAP7+//+n/v//bgAAABIAAACO/v//R/7//wgoAAABAAAAAQAAAAAAAABaAAAA9v///wEAECceAHgEeAQCAB4AHgB4BABAAwAeABQAAEAAQAQAFAAUAABAAIAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAAQAAAFoAAAD2////AQAQJxQAeAR4BAIAFAAUAHgEAI8DAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAACAAAAWgAAAAAAAAABABAnPACrBKsEAgA8ADwAqwQADAMAPAAeAAAMAAwEAB4AHgAADAAoBQAeAA8AACgAKAYADwAPAAAoAIAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAAAMAAABaAAAAAAAAAAEAECd4AKsEqwQCAHgAeACrBFVVAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAABAAAAFoAAAAAAAAAAQAQJzwAqwSrBAIAPAA8AKsEAAwDADwAHgAADAAMBAAeAB4AAAwAKAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAFAAAAWgAAAAAAAAABABAnPACrBKsEAgA8ADwAqwQADAMAPAAeAAAMAAwEAB4AHgAADAAoBQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAAAYAAABaAAAAAAAAAAEAECc8AKsEqwQCADwAPACrBAAMAwA8AB4AAAwADAQAHgAeAAAMACgFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAABwAAAFoAAAAAAAAAAQAQJzwAqwSrBAIAPAA8AKsEAAwDADwAHgAADAAMBAAeAB4AAAwAKAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAIAAAAWgAAAAAAAAABABAnPACrBKsEAgA8ADwAqwQADAMAPAAeAAAMAAwEAB4AHgAADAAoBQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAAAkAAABaAAAAAAAAAAEAECc8AKsEqwQCADwAPACrBAAMAwA8AB4AAAwADAQAHgAeAAAMACgFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAACgAAAFoAAAD2////AQAQJx4AqwSrBAIAHgAeAKsEACgDAB4ACgAAKAAoBAAKAAoAACiAiQUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAMAAAAWgAAAAAAAAABABAnBQDOBM4EAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAAA0AAABaAAAAAAAAAAEAECfQB6sEqwQCANAH0AerBJwJAwDQBwUAnAmcCQQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAADgAAAFoAAAAAAAAAAQAQJ9AHqwSrBAIA0AfQB6sEOBMDANAHBQA4EzgTBAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAPAAAAWgAAAAAAAAABABAn0AerBKsEAgDQB9AHqwRwJgMA0AcFAHAmcCYEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAABAAAABaAAAAAAAAAAEAECfQB6sEqwQCANAH0AerBOBMAwDQBwUA4EzgTAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAEgAAAFoAAAAAAAAAAQAQJw8AqwSrBAIADwAPAKsEABADAA8ACgAAEAAQBAAKAAoAABAAeAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAATAAAAWgAAAPb///8BABAnDwCrBKsEAgAPAA8AqwQAEAMADwAFAAAQABAEAAUABQAAEAB4BQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAABQAAABaAAAAAAAAAAEAECdkAKsEqwQCAGQAZACrBAAQAwBkAB4AABAAEAQAHgAeAAAQAEAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAFQAAAFoAAAAAAAAAAQAQJx4AqwSrBAIAHgAeAKsEAAgDAB4ADwAACAAIBAAPAA8AAAgAEAUADwAKAAAQABAGAAoACgAAEAAgBwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAWAAAAWgAAAAAAAAABAAQABACqBqoGAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAABcAAABaAAAAAAAAAAEAECceAKsEqwQCAB4AHgCrBAAgAwAeAA8AACAAIAQADwAPAAAgAEAFAA8ACgAAQABABgAKAAoAAEAAeAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAyAAAAWgAAAAAAAAABAAAAAAAAAAAAAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAADIAAABaAAAAAAAAAAEAAAAAAAAAAAACAAAAAAAAAAAAAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAyAAAAWgAAAAAAAAABAAAAAAAAAAAAAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAADIAAABaAAAAAAAAAAEAAAAAAAAAAAACAAAAAAAAAAAAAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAyAAAAWgAAAAAAAAABAAAAAAAAAAAAAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAADIAAABaAAAAAAAAAAEAAAAAAAAAAAACAAAAAAAAAAAAAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAyAAAAWgAAAAAAAAABAAAAAAAAAAAAAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAADIAAABaAAAAAAAAAAEAAAAAAAAAAAACAAAAAAAAAAAAAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAyAAAAWgAAAAAAAAABAAAAAAAAAAAAAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAADIAAABaAAAAAAAAAAEAAAAAAAAAAAACAAAAAAAAAAAAAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAyAAAAWgAAAAAAAAABAAAAAAAAAAAAAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAADIAAABaAAAAAAAAAAEAAAAAAAAAAAACAAAAAAAAAAAAAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAyAAAAWgAAAAAAAAABAAAAAAAAAAAAAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAADIAAABaAAAAAAAAAAEAAAAAAAAAAAACAAAAAAAAAAAAAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAyAAAAWgAAAAAAAAABAAAAAAAAAAAAAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAADIAAABaAAAAAAAAAAEAAAAAAAAAAAACAAAAAAAAAAAAAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAAyAAAAWgAAAAAAAAABAAAAAAAAAAAAAgAAAAAAAAAAAAMAAAAAAAAAAAAEAAAAAAAAAAAABQAAAAAAAAAAAAYAAAAAAAAAAAAHAAAAAAAAAAAACAAAAAAAAAAAAAkAAAAAAAAAAAAKAAAAAAAAAAAACwAAAAAAAAAAAAwAAAAAAAAAAAANAAAAAAAAAAAADgAAAAAAAAAAAA8AAAAAAAAAAAAAADIAAABaAAAAAAAAAAEAAAAAAAAAAAACAAAAAAAAAAAAAwAAAAAAAAAAAAQAAAAAAAAAAAAFAAAAAAAAAAAABgAAAAAAAAAAAAcAAAAAAAAAAAAIAAAAAAAAAAAACQAAAAAAAAAAAAoAAAAAAAAAAAALAAAAAAAAAAAADAAAAAAAAAAAAA0AAAAAAAAAAAAOAAAAAAAAAAAADwAAAAAAAAAAAAAAMgAAAFoAAAAAAAAAAQAAAAAAAAAAAAIAAAAAAAAAAAADAAAAAAAAAAAABAAAAAAAAAAAAAUAAAAAAAAAAAAGAAAAAAAAAAAABwAAAAAAAAAAAAgAAAAAAAAAAAAJAAAAAAAAAAAACgAAAAAAAAAAAAsAAAAAAAAAAAAMAAAAAAAAAAAADQAAAAAAAAAAAA4AAAAAAAAAAAAPAAAAAAAAAAAAAAABAAAAAAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAAAAAACAAAAAAAAABMAAAAKAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABMAAAADAAAAAAAAABQAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABQAAAAEAAAAAAAAABUAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABUAAAAFAAAAAAAAABMAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABMAAAAGAAAAAAAAABYAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABYAAAAHAAAAAAAAABUAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABUAAAAIAAAAAAAAABQAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABQAAAAJAAAAAAAAABMAAAAKAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABMAAAAKAAAAAAAAABMAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABMAAAALAAAAAAAAABUAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABUAAAAMAAAAAAAAABQAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABQAAAANAAAAAAAAABQAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABQAAAAOAAAAAAAAABUAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABUAAAAPAAAAAAAAABMAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABMAAAAQAAAAAAAAABQAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABQAAABkAAAAAAAAAAwAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAwAAABlAAAAAAAAAA0AAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAA0AAABmAAAAAAAAAA4AAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAA4AAABnAAAAAAAAAA8AAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAA8AAABoAAAAAAAAABAAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAABAAAAD/////AAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAEAAAD/////AAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAEAAAD/////AAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAEAAAD/////AAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAEAAAD/////AAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAEAAAD/////AAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAEAAAD/////AAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAEAAAD/////AAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAEAAAD/////AAAAAAEAAAACAAAAAwAAAAQAAAAFAAAABgAAAAcAAAAIAAAACQAAAAEAAAAUtTqriMIVt2CeoLYUPD2rAAAAACkEAADgwCGrDWPNtmCeoLaXvLG2AAAAAAAAAAAAAAAASQAeAEEAGQA3ABMALQARAAAAEQAAAAAASQAPAEEADwA3AA8ALQAPAAAACgBHAHAEZADABGQAMAVkAJAFZAAABmQAYAZkAMAGZAAwB2QAkAdkAAAIZABgCGQAwAhkADAJZACQCWQAAApkAGAKZADACmQAMAtkAJALZAAADGQAgAxkAAANZACADWQAAA5kAIAOZAAAD2QAgA9kAAAQZACAEGQAABFkAIARZAAAEmQAgBJkAAATZACAE2QAABRkAIAUZAAAFWQAgBVkAAAWZACAFmQAABdkAIAXZAAAGGQAYBhkAPAYZACQGWQAMBpkAPAaZACgG2QAcBxkADAdZAAQHmQAAB9kAAAgZAAAIWQAECJkAFAjZACAJGQA4CVkAGAnZADwKGQAoCpkAIAsZACALmQAwDBkADAzZADgNWQA4DhkADA8ZAAAQGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAGQAAABkAAAAZAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP/nD+739vX0AQADABQAAACUCAAAGA0AAAAAAAQCAAAAAQAABAIAAAACAAAEAAAAAAMAAAQAAAAABAAABIAAAAAFAAAEAAAAAAYAAAQAAAAABwAABAEAAAAIAAAEZAAAAAkAAARbAAAACgAABAAAAAALAAAEAQAAAAwAAAQBAAAADQAABAEAAAAOAAAEAQAAAA8AAAQBAAAAEAAABBQAAAARAAAEHgAAABIAAAQeAAAAEwAABAAAAAAUAAAEAAAAABUAAARkAAAAFgAABAAAAAAXAAAEAAAAABgAAARkAAAAGQAABAAAAAAaAAAEAQAAABsAAARkAAAAHAAABAAAAAAdAAAEAAAAAB4AAAQAAAAAHwAABAAAAAAgAAAEAAAAACEAAAQAAAAAIgAABAAAAAAjAAAEAAAAACQAAAQAAAAAJQAABAAAAAAmAAAEAAAAACcAAAQAAAAAKAAABMgAAAApAAAEZAAAACoAAARlAAAAKwAABGQAAAAsAAAEyAAAAC0AAARkAAAALgAABGUAAAAvAAAEZAAAADAAAATIAAAAMQAABGQAAAAyAAAEZQAAADMAAARkAAAANAAABHAAAAA1AAAEAAAAADYAAARuMgAANwAABMAfAAA4AAAEwB8AADkAAATAHwAAOgAABMAfAAA7AAAECAIAADwAAAQIAgAAPQAABAgCAAA+AAAECAIAAD8AAAQBAAAAQAAABG5gDABBAAAEWAIAAEIAAAQAASCxQwAABG5hLLtEAAAEMQADAEUAAAQZBQEFRgAABAAAAABHAAAEAAAAAEgAAARuYAwASQAABFgCAABKAAAEAAEgsUsAAATwTxEATAAABEECAABNAAAEfQIABE4AAARdAgAETwAABPwPAABQAAAEAAAAAFEAAAQQAAAAUgAABAQKoBBTAAAEAAAAMFQAAASA8AAAVQAABEjwAABWAAAESACAAFcAAAQgICAgAAAAAAAAAABZAAAECAilBFoAAAQelQcAWwAABHpUHgBcAAAEhes1AF0AAAT/D/8PXgAABP8P/w9fAAAEYgMAAmAAAAQAAjYDYQAABNoP2g9iAAAE2g/aD2MAAAT/D/8PZAAABP8P/w9lAAAEaQMEAmYAAAQEAjwDZwAABNoP2g9oAAAE2g/aD2kAAAQAAAAAagAABAMOAABrAAAEAyAYAWwAAAQFEgiAbQAABAhjjAFuAAAECjAAAG8AAAQhmiQAcAAABCGgJABxAAAETf4lAHIAAARkuCUAcwAABKWUUgB0AAAEhBBCAHUAAAQIIYQAdgAABOeccwB3AAAEAAICAHgAAAQPAAAAeQAABGgkD0t6AAAECgAAAHsAAAQfIhIAfAAABAAAAAB9AAAEDrABAH4AAAQUAwsffwAABOEfAACAAAAEYh9BA4EAAARdHwAAggAABMYflR6DAAAEpQMAAIQAAASZAC0BhQAABDoAAACGAAAEqgdWB4cAAAQAAQAAiAAABAABKgeJAAAE1gcAAIoAAAQgAAQBiwAABAwKAACMAAAEAhECAI0AAAQCEAIJjgAABAoKAACPAAAEKGSgAJAAAAQQEBAIkQAABAAAHB6SAAAEHDVNcZMAAAQKAQ0AlAAABC5Yf7mVAAAEBAAAAJYAAAQICQoMlwAABHg8GbmYAAAEAAAGAJkAAAQAAAAAmgAABFI/ACibAAAEAEAAQJwAAAQAAAAAnQAABCh4ehCeAAAEBDAnQJ8AAAQNAAAAoAAABAAAAAChAAAEJwAAAKIAAAQAAAAAowAABAAAAACkAAAEAAAAAKUAAAQAAIIApgAABAACAACnAAAEqHFNPqgAAAQAAB4AqQAABEEBRgCqAAAEeQF1AKsAAAS5AHUArAAABAD/AACtAAAEFxcAAK4AAAQbYgAArwAABBACAQGwAAAEIAEBALEAAAQwAQIAsgAABA0NBgazAAAEAwMAALQAAAQBAAAAtQAABAAAAAC2AAAEAAAAALcAAAQAAAAAuAAABAAAAAC5AAAEAAAAALoAAAQAAAAAuwAABAAAAAC8AAAEAB8fH70AAAQ5ZJTDvgAABAIEAgS/AAAEAgQCBMAAAAQCBAAAwQAABAIEAgTCAAAEAgQCBMMAAAQCBAAAxAAABAIEAgTFAAAEAgQCBMYAAAQCBAAAxwAABAYEABDIAAAEEQAEAMkAAAQwARAQygAABID7AgDLAAAEAP8AAMwAAAQBAP8CzQAABIAA+wDOAAAEAAAAAM8AAAQEIRko0AAABAAAAADRAAAEAAAAANIAAAQAAAAA0wAABAAAAADUAAAEAAAAANUAAAQAAAAA1gAABAAAAADXAAAEAAAAANgAAAQAAAAA2QAABAAAAADaAAAEAAAAANsAAAQAAAAA3AAABAAAAADdAAAEAAAAAN4AAAQAAAAA3wAABAAAAADgAAAEAAAAAOEAAAQAAAAA4gAABAAAAADjAAAEAAAAAOQAAAQAAAAA5QAABAAAAADmAAAEAAAAAOcAAAQAAAAA6AAABAAAAADpAAAEAAAAAOoAAAQAAAAA6wAABAAAAADsAAAEAAAAAO0AAAQAAAAA7gAABAAAAADvAAAEAAAAAPAAAAQAAAAA8QAABAAAAADyAAAEZGFvbPMAAAQAAAAA9AAABAAAAAD1AAAEAAAAAPYAAAQAAAAA9wAABAAAAAD4AAAEAAAAAPkAAAQAAAAA+gAABAAAAAD7AAAEAAAAAPwAAAQAAAAA/QAABAAAAAD+AAAEAAAAAP8AAAQAAAAAAAEABAAAAAABAQAEAAAAAAIBAAQAAAAAAwEABAAAAAAEAQAEAAAAAAUBAAQAAAAABgEABAAAAAAHAQAEAAAAAAgBAAQAAAAACQEABAAAAAAKAQAEAAAAAAsBAAQAAAAADAEABAAAAAANAQAEAAAAAA4BAAQAAAAADwEABAAAAAAgAQAAABwAHAccBxwOHA4cFRwVHBwMHAwfDB8MIgwiDCUMJQwoCCgIKgwqDC0ILQgvDC8MMggyCDQMNAw3CDcIOQw5DDwgPCBEJEQkTSRNJFYkViRfIF8gZyRnJHAkcCR5JHkkgiCCIIokiiSTJJMknCScJKUgpSCtJK0ktiS2JL8kvyTIJMgk0STRJNok2iTjJOMk7CTsJPUk9ST+JP4kByUHJRAlECUZJRklIiUiJSslKyU0JTQlPSU9JUYlRiVPJU8lWBVYFV0VXRViFWIVZxVnFWwVbBVxFXEVdhV2FXsVexWAFYAVhRWFFYoVihWPFY8VlBWUFZkVmRWeFZ4VoxWjFaghqCGwJbAluSG5IcElwSXKIcoh0iXSJdsh2yHjJeMl7B3sHfMd8x36HfodAR4BHggeCB4PHg8eFh4WHh0eHR4kGiQaKh4qHjEaMRo3HjcePho+GkQeRB5LGksaUR5RHlgaWBpeGl4aZBpkGmoaahpwGnAadhp2GnwafBqCGoIaiCaIJpEmkSaaJpomoyajJqwmrCa1JrUmvia+JscmxybQHtAe1yLXIt8e3x7mIuYi7h7uHvUi9SL9Hv0eBCMEIwwXDBcRGxEbFxcXFxwbHBsiFyIXJxsnGy0XLRcyGzIbOBc4Fz0XPRdCF0IXRxdHF0wXTBdRF1EXVhdWF1sXWxdgQ2BDcENwQ4A7gDuOO447nCecJ6UnpSeuJ64ntye3J8AjwCPII8gj0CPQI9gj2CPgI+Aj6CPoI/Ab8Bv2G/YbABwAAAccAAAOHAAAFRwAABwMAAAfDAAAIgwAACUMAAAoCAAAKgwAAC0IAAAvDAAAMggAADQMAAA3CAAAOQwAADwgAABEJAAATSQAAFYkAABfIAAAZyQAAHAkAAB5JAAAgiAAAIokAACTJAAAnCQAAKUgAACtJAAAtiQAAL8kAADIJAAA0SQAANokAADjJAAA7CQAAPUkAAD+JAAAByUAABAlAAAZJQAAIiUAACslAAA0JQAAPSUAAEYlAABPJQAAWBUAAF0VAABiFQAAZxUAAGwVAABxFQAAdhUAAHsVAACAFQAAhRUAAIoVAACPFQAAlBUAAJkVAACeFQAAoxUAAKghAACwJQAAuSEAAMElAADKIQAA0iUAANshAADjJQAA7B0AAPMdAAD6HQAAAR4AAAgeAAAPHgAAFh4AAB0eAAAkGgAAKh4AADEaAAA3HgAAPhoAAEQeAABLGgAAUR4AAFgaAABeGgAAZBoAAGoaAABwGgAAdhoAAHwaAACCGgAAiCYAAJEmAACaJgAAoyYAAKwmAAC1JgAAviYAAMcmAADQHgAA1yIAAN8eAADmIgAA7h4AAPUiAAD9HgAABCMAAAwXAAARGwAAFxcAABwbAAAiFwAAJxsAAC0XAAAyGwAAOBcAAD0XAABCFwAARxcAAEwXAABRFwAAVhcAAFsXAABgQwAAcEMAAIA7AACOOwAAnCcAAKUnAACuJwAAtycAAMAjAADIIwAA0CMAANgjAADgIwAA6CMAAPAbAAD2GwAAtAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP/o/hr//v38AAABAAwAAAAAEAAAEAAAABAAAAAECngAAABwIAC4AABwAokZBAp4AAAAcCAAuAAAcgK5GQQKeAAAAHAgALgAAHICuRkFCngAAACAIADIAAB6FlkbBAxAAAwCkCAVdAAAZa4oFgQQQAAMApAgFnAAAGeuSBYECFAADAKQIBV4AABnrkgWBQxQAA4CoCAWeAAAb76oFwMGWCABAmAgIlAAAEqGWBMECjggAABgICFYAABLhngTAgJQIAECcCAjUAAAS4J4EwQKSCABAHAgJFwAAFKSmBQCAFAgCQKAIBQoAAAvYogRBQSAIA0CcCAZGAAALmKYEQEESCAIAoAgEzAAADBimBEEBGAgDAKAIBckAAA1aogSAQAQAAMCcCAGCAgAIV5IEAEGWAADAGAgAQYIACJmaBABAAAABAKQIAgECAAiWlgQAAQ4AAEAgCAEBAgAJ2oYEQEGGCACAIAgCggIABpiWA8BDiggAABwIA4QAAAcYmgPAQQgIAAAkCAJHAgAGmJoDwEGKCAAAJAgDAAAAB9q+A8BABAAAQKAIAYICAASZrgOAwQQAAQCoCAGEAgAEl64DgEGOAADAHAgBAAAABNquA4CABAAAgKQIAgICAAVbjgPAQIAAAIAgCAJBAgAC2o4DgICECAFAJAgCQwIAApqSA4BAAAAAQKQIAsAAAAMajgOAgIQAAQAoCAKBAgADHKoDgEEAAABAoAgCQQIAAFqCA4CBCAAAgKAIAcECAACahgOAQoQIAEAkCAKBAgAAWoIDgEIECADAqAgDAQIAAJueA4AAAAAAgBwIAgEAAAHaCgOAQYoIAQAcCAMDAAAB2goDgQEEAACAnAgBwwIAAhsKA4BAAAAAQCAIAoECAAJdJgOAgoYIAIAcCAJGAAAEGSIDgECEAAAAIAgBxQAABBgiA4GEiggCQBQIAkkAAAQbIgOBAoIAAUAcCAJIAAAE3AIDwAEEAADApAgBQwAABdYGA8AACAgAwKAIAkIAAAYWCgPAwwwAAgCoCADDAAAF1QoDwIEAAAHAqAgCAwAABxguA8BBgAAAgKAIAkMCAAeWOgPAQogAAECgCAEEAgAH1gIEAIGICAAAHAgDQwIAB9Y+A8BChAgAQKAIAkUCAAlYLgQAQboAAQCYCAHGAgAJmD4EAEG6AAEAmAgChwIACZkGBEABPgABQJgIAUYCAAoZBgRAQb4AAQCcCAHHAgALXAIEgAIWCAGAnAgMjwIAEJ0eBIBCmggBgJwIDRACABFfKgSAQpIIAYCcCAxPAgAQ3ioEgAIWCAHAoAgNUAIAEuEyBMCALAgBwKQICJ4CABsoEgVAwCwIAgCkCAhfAgAb6iIFQMAwCAIApAgJXwIAG6keBUDBMggCAKQICV8CAB4tOgWAQwwAAAcOAEAiEAhWippFwIEMAAAFFgBAIxgIVwumRcABDAAABRYAQCUYCFcLpkXAQgwAAAcaAEAlHAhYkYZGQYeiAAEIGABCYCwIVbmqBQIKogABSxgAQqIsCFX5sgUAxaIAAAUYAEKfLAhV+bIFAgmqAAEKIABCIzgIV76CBYFAHAgEA74ACFgMCFAqjgSCAhwIBQayAAiYBAhQapYEgIMeCAKBhgBImBgIUGuWBIHBJAgExboACVoQCFIulgTAgY4IAAE4AAMFHAhKo6oEAMOOCAEENAADAxgISqOuBABCDAgBhLoAAwYcCErkrgQAgYoIAEI8AALEJAhMJ6IEQIAMAAGBtgAAwBgISKKeA8BBEAABg6oAAMMICEjiogPAwQoAAMCAAEEEKghI46IDwIEMAAGCugABQSAISiaKBAABCAgAQjYAAsUeCEbjngOBBhAIAMiuAAOGFghG46IDgMOGCAFEAABCQyoIRyWiA4ABCAgAQj4AAwQqCEgnggPAAQgAAEE6AAFDJghE5bIDQQGSAAIDBABAhjYIROa2A0DDBAABRLIAAcEaCEUlsgNAAgwAAEECAEGEMghFqY4DgEEGCAABPAACwSYIQuaSA0DCDggAwYAAQ0EoCELnlgNAQIAAAQA8AAKDKghC55IDQEEKCABACABDgTYIQ2qqA0CChgABBDgAAgEkCEBmhgNBAIwAAUM0AAFAJAhApooDQAUKCABFPAACwigIQGeGA0CDhgABBQAAQkE0CEBqngNAQQIAAMGyAAKEFAhCJQ4DQQEMCAGDtgADxBgIQiUOA0EDkgAAhCwAAUUUCEHlDgNAAgYAAIG0AALFHAhCaCIDQEMMCAAFLgACwRgIRKQmA0EBggABgTgAAcMkCETkKgNCCiAIAo2eAASBAAhE4yYDQIUQCADHrgADghgIRacCA4BDigAAgzgAAIIoCEZjEgOBQQQIAYGyAAHBIAhGYhYDgcaaAAOIBABBQbYIRmQWA4BCigABBAAAQIE2CEemNgOAwYYIAAQwAAHCHAhHYQoDwYKGAAIGNAAAwSYIR6IOA8BAEAgCAqwAA0UUCEehCgPAwYoIAAU4AAJBJAhI5TYDwAU4AAJErgAAxQoISKEGBABDNAADAq4AAYMOCEiiDgQAhLgAAQKuAABHDghJIg4EAAQ4AAJDsgABBRIISmYCBEBGGAgCBoIASxUaCE6oHgRARRwIAgW+AAuVFghPKSYEQIcUCAKGvgAK1BYITukmBEAFGAgCBYYAS9UeCFCtJgSAQSQIAQGWAEahMghXdjYEwEEgCAEBkgBGYioIWDcGBQBCKAgBAZoAR2IuCFe3AgUAgygIAcSaAEdjMghaOxYFQISSAAABGAgAHxgAkwKGRUDClgAAAx4IAB8gAJMCjkVAQo4AAAMeCAAdIACTAo5FQMOSAAABIggAISgAlIeiRYAFCAABzqoIA14YAJFzsgSAhwAAAhOmCAPeFACRdLoEgMKUAADKpggCXhQAkfS6BIBHCAACEq4IAx8kAJM4ggUAgQgIAcWWCASLIABNqLYEAECEAADBiggDSQwATem+BAFDGAgDCZ4IBc0wAE3ougQAQAgIAUOSCASKIABPbLYEQAEWCACDkggDAgwASeWaA8CBGggBhYoIBAUIAEpmngPAw4oIAQMQCAGBDgBKJZ4DwEISCACCjggDBBQAS6mKBABCFAAAQZYIAIWCAEjlkgOAQhQAAEAMCADHsgAI5ZYDgEIQAAEBoggAQhoASWWSA4ABFAAAABQIAEWKAEpotgOAAAgIAEIMCAMFPgAHp44DQEOCAADJBAgChzIAB+eSA0BDEAgABRoIA4MWAEdnjgNAQAgIAAIQCAOFCgBIq6oDQIKKAACDDAgBgQYARWmeAwCCggAAQRQIAoMUAEVqngMAQpIAAMUICACEPgAFaZ4DAMOOAAEEEAgBwRIARi2yAwCDAAAAw5YIAwESAEMpvgLBRQAAAUaeCAKDFgBC6b4CwECECAAAFAgDgRAAQ2q6AsDDBAgBRJ4IA4AgAENsigMAgIQIAMMKCAMCBABAKjICwUSCAAJCCAgCggAAQGuyAsCFCAgBCZYIA0IQAEBqLgLAgYQIAQUSCAMCFABALT4CwIMEAACCjggBwDgAAmg6AsCCBAABQZYIAkIEAEJoOgLAgwAAAIUCAAHCLgACqjoCwIMEAACEjggCQAAAQuwKAwDEiggBRQAAAoEwAASpFgMAQRAIAEMOCANBBABFKRYDAYqCAAIQEAACABgABKkWAwCEiggBBwAAAwEyAAWsKgMAxAQAAQWSCAFEBABGpwIDQEGMAADCCAgAATYABqgGA0FFBAgCiZ4IAkkYAEaoAgNAgwQAAMOSCAFDDABHqx4DQEGSCADBBAgBwjQACCY6A0ABGggAQIQIAoY8AAgnPgNAwY4IAYIICAFBMgAIZT4DQEGWCADBCAgCQwAASWoiA4CEugAAS4gIAYO6AAgkPgOAwb4AAAgICAGEvgAIpAIDwEOyAADJiAgBA74ACKQCA8DDvgAASowIAUOGAEnoLgPAAxYIAguUCAkNJgBL5wYEAEMaCAKKkAgJjh4ATKgOBACEjggBTZQICE4iAExnDgQAAhYIAkqYCAnOLgBOKwYEQMMcCAJCoAgFnBIAkzIGBICEHAgBwpgIBV4GAJPzEgSBAiAIAsSkCAZbFgCTsg4EgMIcCAIGoAgFoBYAlbcaBMAFCAAACxYIABIQAE+logTAQ4gAAAgSCAASDABP5aoEwAIIAAAIEggAEggAT+WqBMAEBAAACxIIABMQAFEotgUAgooAAECAAAGMJAAO3KYEQAQKAACEhAgBiygADxyuBECBiAAAQ4YIAY4oAA8crgRAg44AAEOAAAEMJAAQn64EgECAAAFBiggCxSQADNe6A8DAgAAAwpYIAsg4AAzYvgPAgAAAAgGGCALDHAAM174DwECECAGCkggDRzAADpqyBAGEEAgBxooIAociAAoYngOCBhAIAseaCAKHMgAKV6IDgMMQCADHhggChRoAClmiA4GFEAgCCJIIAoYqAAvaigPBRJoAAsUEAADHigAJXJIDQUOWAAMEAAAAyZYACVyWA0DDmgABxQwAAMaGCAlblgNBA5YAAoQEAABHjgAKnrIDQEAICADAiAgDghwAB9yOAwBAhAgAgo4IA0QkAAgdjgMAQg4IAIWAAAPBDgAIG44DAEGGCABCiAgDghgACR6iAwCDAAAAhIoIAgMiAAVdmgLBRQgIAUWKCALDHgAFHJoCwAIMAAACDggBQCAABZ2aAsDFAAAAxo4IAoEiAAYfpgLBQ4oAAYUEAAJBEgADHboCgcWWAAKJCAABQwoAA166AoBAiAgAAAAAA8EYAAMdtgKBA4oAAYUIAAKCDgADn4ICwYMMCAIDjggDwCQAAF2qAoHHFAgCyY4IBMIsAABeqgKAggIAAIaECAJEGgAAXaoCgUIMCAHBhggEASIAAF+yAoHEjgAChgAAAUAYAAJeNgKBhY4AAsUQAAEBBgACnzYCgUKKAAGFDAgCQTAAAh4yAoGDjgACRQAAAcEeAALhPgKCBBQIAseOCAPEMAAFHRICwcAMCAJBhAgDQRwABN0SAsGHGAgCjpoIBAcEAEVdDgLBwxAIAkaOCAQEMAAFoB4CwcSOAAMHAAAAARIABtwCAwIEigACxAQIAMQgAAbdAgMBApIAAkUEAABFigAHHAIDAYOOAAKFAAAAwBgACB8WAwFBGAgCAo4IAoYsAAhaOgMCAxQIAwSWCAKFMAAImT4DAIEaCADAhAgCxhwACFs+AwFCGAgCA44IAwYsAAndGgNBQLAAAcAICAHEpAAImQIDgkOuAANFCAgBg6AACNkGA4CAsAAAgQgIAcSgAAkZBgOBgbIAAgIECAHDoAAKWy4DgIEUCAJCiAgHASYAC1YKA8FCEAgDwpQIBwIyAAuWEgPAQZAIAQGICAcBIgALlxIDwIEUCAKDjAgHQioADVkGBABHEggBDIQIA1EuABBaPgQACRYIAE8MCAPSOgAQ3AYEQMQWCAIJhAgDzyoAENoGBEBHFggBDIgIA5A2ABKeCgSAQooAAAMQCAAKFAAOWKYEgIKGAAAAEAgACxgADlmuBIABCAAAARoIAAkcAA5ZrgSAQoYAAAEUCAALGAAPm7YEwAIAAAEFmggBSRwADZS2BABFBAABSZYIAQgYAA3UvgQAgYYIAEGWCAFJGAANlL4EAAMEAAEHmggAyiAADxa6BECBBAgBApIIAUIOAAxSkgPAwQwIAMKCAAICCggMU5YDwMEEAAGBmggAwRYADJGWA8DBBAgBQo4IAcIGAA3UhgQAgIgAAMUMCADJBgALU7YDQMOSAAFKAAAASZYIC1S6A0BChAgAgxQIAckSAAtUtgNAwYoAAUgICACKBggM1p4DgIMEAADGjggCARoACdieAwDCBAABRYoIAoEUAApXogMAQwwAAEWSCAECHgAJ2KIDAMMEAAEFjggCQRoAC1q6AwBBhAgBAAAAAoQCAAeYmgLAAggIAMECAALFBgAH2JoCwAIMCACCBggDQwoAB9maAsACCAgBAgIAA0QGAAjbqgLAg44AAIYEAAGBBAAFmaYCgMWOAAEJCAABgAAABZmmAoDDjgAAxQgAAUEAAAWZpgKAhY4AAMgIAAHBAAAGW64CgMMMCAEFiggDwxwAAxiCAoEECAgBh44IA8QkAAMZggKAgggIAQGGCAPCEAADGIICgIIICAEEiggEBCAAA1qKAoDEjgABBgQAAcEKAABYtgJBR4oAAcsEAAIBCgAAWLYCQAEIAABBBgACAAwAAFi2AkCDigAAhAAAAkESAABZugJAwhAIAUaKCAPEHAACmD4CQUUMCAJJmggDxDQAApc+AkACDggAAgYAA8QIAAKXPgJAgQwIAMWKCAQEIAAC2QYCgEGOAADEAAABBAYABRYeAoDBjgABgAQIAUMSAAUYHgKAgQYAAEaECAGGBggFVR4CgAAIAACCBAgBxA4ABdgmAoABDAgABQoIAwYUAAcXDgLAghgIAIeGCAOFEAAHlw4CwMOCAAFBBAgCBRQABxgOAsAADAgARAYIA0UUAAhZHgLAQQYIAAEECACBAAAI1Q4DAISOAAEFBAAAgIwICRUSAwDCEAgBQ5IIAgQYAAkVDgMAAgYIAAIECAECBAAKVyoDAIGaAADACAgABAQACRQWA0BBCAAARI4IAYgMAAmUGgNAgKQAAUAICAFBiAAJlBoDQAAYAABCDggARBAACtY+A0DDjggAhYwIBMMIAAuRJgOBhIYAAEcICAMCBAgL0C4DgQWaCABFiAgFxQgAC9IqA4GFjggARgwIBQQIAA2TGgPBBQwIAseeCAJHHgAPEhIEAUkUCAPNnggDxhoAD1IaBAEECAgDBJ4IAcgeAA+SGgQBRwwIA8qiCAKHIgARFBYEQEKAAAAEFgAACCAIDNq2BEBEAAAABQ4AAAQUCA0ZvgRAgYYAAAEgAAAKLAgNWr4EQAMAAAAEFgAABxwIDluCBMBAgAAAgZwAAEQsCAzWkgQBBIoAAIYcAABDqAgNFpYEAIQICAGEmgABBSgIDNaWBACBhgAAQ6AAAEOsCA5YjgRBAAQAAQKcAABDKggMla4DgYEECAJAjAABQhIIDJauA4BBEgAAAygAAMS6CAyWsgOBQAgAAYKcAACDJggOWJ4DwQWCAAHGHAABQCQIC5eKA0GDggACghAAAQEQCAuYjgNAxooIAQgkAAJBLAgMF44DQUWGCAIFHAABwRwIDRquA0EBDAABg4gAAUIOCApWsgLBAgwAAcKEAAECCggKlrYCwQAQAAGDjAAAwhIICpa2AsEBEAABw4gAAUEKCAvXigMAw4oIAUMMAAOBBAAIGKoCgQWKCAGGDAADwQAACBiqAoEDiggBhRAAA8AAAAgYqgKBBYoIAYUMAARCBAAJGbYCgMIEAAFEggACBBAABVa2AkEEAAABh4oIAkQYAAVWtgJBAQQAAYSCAAJFFAAFVrYCQQMEAAGGhggChRwABde+AkDEggABRggAAsAAAALVlgJBRIoAAcYIAAJABAgC1ZYCQIOGCAFECAACwAAAAtWWAkDDggABRAgAAwAEAAMWmgJAQwAAAUWKCALFFAAAFAoCQUUMCAJKhggDhRQAABQKAkCAiAAAgIQIAkQUAABUigJAAgAAAQSGCALEFAAAVY4CQMEECACAhAACxQIAApQWAkCEigABRxAAAYYWCAKUFgJCBQwIAkiGCAPEFgAClBICQQIECAEChgADBQYAAtUWAkFAiAABwAgAAcAAAATWMgJAQoAAAAECAALBCAAElTICQgSOAAOEEAABQQoIBRcyAkFCigACAgwAAgEGCAWXOgJBAQwIAcOKAAMBAAAHVSICgMAMCAEBigADAgIAB5UiAoFEDAgCx4IAA0UEAAdVIgKBAgwIAgSGAAOCBAAIVi4CgEKAAAECDgAAgw4ICRYmAsCEhAABBgoAAIEGCAlXJgLAAQYIAUEQAADFGggJVSYCwAIECAEDDgABAw4ICpc6AsCBlAAAghYAAIQUCAmWLgMAQIwAAAIaAAFDGAgKFjIDAUCgAAFADAAABBQICZUyAwEAmAAAwRYAAIMYCAtXEgNARBgIAUaWAARBIAgMFAIDgAQQCACGmgADgSAIDFUKA4EGJAgCypIABYIUCAxTBgOAxiQIAgmWAAVCHAgOFjYDgEQGAACJpAAAjLYIDdUuA8BHAgAAjqgAAA06CA4WNgPARIoAAMgoAAFOvggOljYDwAYKAAAMLAABT74IEBcyBABEggAAAxgAAAgcAAwaggRAh4IAAAggAAAKDAAMmooEQAAECAADDgAABjAADBqGBECGhggABRwAAAkcAA2cigSAQgYIAMGIAABFrAAMVqIDwQIICAHFhgAARiwADJamA8BGggAABwwAAIOoAAxWpgPAgQIAAUCEAACGsAAN2JoEAIGWAABCAAAAwbAADJW+A0EBmgABAwwAAQKaAAzVggOAQpYAAIGICADEgABM1YIDgMGaAACCAAAAwLAADpaqA4GFEAgBiYYIAwA0AAuVmgMBxBQIAgiKAAOAJAALlp4DAQYUCAFKkggDQAQAS5SeAwGFGAgByYYIA8E4AA0WugMBxZ4AAsUQAABAkAAKFYYCwoeiAAPJGAAAwoQAClaKAsFDogACRAgAAMCcAApUigLCBaIAAwYQAACBlAALVp4CwUQUCAJGhggExSQAB9O+AkJHGAgECoYIBUYoAAfTvgJAgxgIAUWGCAVGKAAH074CQYUYCALIhggFxiwACNOKAoDBkgABggwAAQISAAUSjgJBhJIAAwYYAADEAgAFE44CQEGQAABABAAAwhoABRGOAkEBkgABwxAAAQMKAAWTkgJAgwwIAQWKAAQEGAACkq4CAMIQCAHFigAEBhgAApKuAgACDAgABAoABAMYAAKSrgIAggwIAQSOAAREFAAC07ICAIGGAACDFAABggIAAFEmAgDDigAAxhAAAUMGAAARJgIAAAAAAAAQAAHABAAAUSYCAEGGAABCEAABwgoAAFImAgCBCgAAwpAAAkIOAAISLgIBgwAAAYWKAALBHgACUi4CAISSAABJEAABhAYAAdEuAgBCDgAAg5AAAkMSAAJSMgIAwY4IAQAMAAOBFAAE0woCQcWGCAKFFAACgAgABNMKAkDFGAgBCIIABMEoAATTBgJAQZAIAIMKAARBHAAFVA4CQMEEAAEBiAABQxYAB1I6AkHDBAgCwoIAAgEeAAcSOgJAgooAAUUUAACGCgAHkzoCQIEEAADBjAABhRIACFMGAoDBhggBQwwAAcIaAAiVOgKBg4IAAoUMAAGDFgAI1DoCgIIECACBjgABwBwACNU6AoBBhggBAxAAAgMaAAoWDgLAQAgAAMCIAAEDJAAKFAIDAMIIAAGBggABQiwAClMGAwCBigABARQAAQMUAApVBgMAAAwAAAAMAAFDIAALliIDAIOWCABGDAADAiIADBMaA0DDlggAxQgAAsIqAAxUHgNARJYIAMmQAALBGgAMUx4DQISaCABIjAADQiIADdUGA4CFBAABhIIAAMW6AAzVPgOAhgQAAcaGCACDvgANVQYDwIUEAAFFhggAhb4ADVUGA8CGBAABhoYIAQWCAE7XPgPABQQIAAkuCAAAKABLSZoEAEgICAAOLggAADAAS0qiBABBhAgAAiYIAAIYAEuJogQABwgIAAsyCAABMABMSp4EQESEAABFGggBAYYAS8mCA8CBiAAAwAwIAYO6AAwJhgPARwQIAMqiCACBkABLyIYDwAQIAABEFggBwoYATUm6A8BBDAAAQoYIAIGyAAyJogNAQgoAAEGICAACOAAMyqIDQEQQAAAFBggBRKYADIimA0AADAAAAgYIAECwAA5KigOAhIYAAIYECAGDKgAMCr4CwIKKAACFEAgBgj4ADAm+AsBFhggAyAwAAkQSAAwKggMAQ4YAAEYECAIDLgANSpoDAIUAAADJkggCggAASgumAoFGCAgBjZoIAwMQAEnLpgKABAwAAEaKCAGCMAAKS6oCgIUAAACJkggCggAASwy6AoCEggABBgQAAoIiAAeKogJBRY4AAkoAAAFFIgAHiqICQIMSCABDiAADwRoAB4qiAkCFggABCAQAAsMeAAhKqgJAAAQAAEGOCAJDNAAFCq4CAIIICAGFmggDhggARQquAgDDkgABBAQIAQEkAAUKsgIAAAQAAEGSCALEPAAFirICAAIGCAADDAgDADAAAkmSAgBBggAAgRAIAkE2AAJJkgIAgAwIAQGQCAPCNAACiZICAAAECABBkAgDQDgAAomSAgBBBAgAQZYIAgA8AABJCgIAQQQIAEKSCAIBOAAACQoCAECAAABAEAgBgToAAEkKAgAABAgAABAIAkA8AAAJCgIAgpAAAEAQCAGBOgAByRICAICUAACDDAgBQzYAAckSAgADDAAAAxIIAcE4AAHJEgIAQ5AAAAESCAHBOgACCRICAMIYCADDiggEgToABMoqAgFEIAgBiI4IBUEAAEUKKgIAQooIAAUECAPDLgAEiSoCAIEUCADBiggEgjYABUouAgCDkgABRAQIAEIuAAcKHgJBRJoAAkcEAADDngAHCh4CQIEGCABAkAgBwQAAR0oaAkDDjgABRQQIAMEyAAgLJgJAQQ4IAICQCAMEPAAIihoCgQAYCAHDjggEBjwACMoaAoDDhgABBBQIAUEAAEjKGgKAgQoIAMCQCAMEBABJyioCgEGSAABBFAgAgjwACkgmAsEDlgABhAwIAICsAAqIKgLAQQAAAQOeCAJFEABKiCYCwIGOAACAFAgBQgQAS8kCAwCDHAgAw5oIA0EAAEwHPgMAwyAIAYOaCAPCAABMRwIDQEMUCAAEGggCQQYATIcCA0DEIAgAxJoIA0AEAE4IKgNARY4AAQsMCAKEtgAMRyIDgEWOAAEMDAgCRbYADMcqA4BFjgAAywwIAgS2AAzHKgOAho4AAU0ICAKFtgAOSB4DwEMGCAAHCAAAAh4IC4GYBABGBggACwgAAAIeCAwAnAQAQAgIAAAEAAABFggLQJwEAEUKCAAJCAAAAR4IDMCYBECEggAAhwgIAMGAAAwAuAOAw4IAAIQQCADElAAMQLwDgAYCAADKBAABQ5IIDACAA8CFigAAhwgIAYGEAA2AsAPAARAAAMGYCADBnAAMwJgDQQYMAAIGnggAQKQADMGYA0EDmgAAiBQIAUGYAA0AnANAAhAAAMCcCABBoAAOgIADgIQECACFlggCQSIADAGyAsCAgAABQQYIAgIKAAwBtgLBxwgIAkimCAMBOgAMQbYCwIQECACElggCQiIADYGSAwDEjgABRgQIAcIOAAoBngKAQQ4AAEWECAHEBgAKQJwCgcaOAALHBAgBQRYACgKeAoDDjgABRgQIAgISAAtBrgKAxAgIAYaWCAOCKAAHgpYCQAIICAAGCggDgxwAB4KWAkFFCAgChp4IA4IwAAeBlgJAhAgIAUeWCAQDKAAIQp4CQICEAAEAAAACAQ4ABMKmAgABBgAAAQAAAkEGAATBpgIAgoQAAYQKCAJBHgAEwqYCAECEAADBAgACgQ4ABUKqAgBBBAgAgoYIAwEMAAJBigIAQYQIAAECAALACAACQYoCAAAECABAgAACwQgAAkGKAgBAhAgAAAAAAwEIAAKBigIAQQIAAAEEAAHBBgAAQQICAIECAABBgAACAQoAAAECAgCAAAAAQIAAAgEKAAABAgIAwAQIAICAAAJBCgAAAQICAISOAADFAAABwggAAcEKAgDFjgABBAAAAYMIAAHBCgIAg44AAQUAAAGBCAABwQoCAMWOAAFGAAABwQgAAgEKAgBADAgBApAIA4AcAASBIAIAgAwIAUSUCAPCHgAEgSACAAEMCADBjggDxBwABIAgAgBADAgBAZAIBAIgAAUBJAIAAgQAAAUSCAGCJAAHABACQICEAACEFggBhCwABwESAkDDBAAAxI4IAYIWAAcBEAJAQgAAAEWSCAIBJAAIABgCQEIICABEiggCgRIACQAQAoDDCAgBA5YIAkIeAAkBEAKAgYgIAQQCAAJBCAAJARICgAIECABDCggCQRIACgAgAoABDAAAgQIAAMECAAqAHALAAggAAQUKCAEBEgAKwSICwIAIAACBhAABAQoICsEgAsCCBAAAQ4YIAcEGAAwAOALARZYIAIYEAAKCBAgMADgDAEWWCACGBAACQgQIDIA8AwCFlggBBgQAAkEECAyAPAMAh5YIAUgEAAJBCAgOACQDQAQIAAAFEggBhZQADIIcA4ADCAAARJIIAUWUAA0CJAOABAgAAEWSCAFFlAANAiQDgEQIAACGlggBh5gADoIYA8ABAAAAAwYAAAIICAuElgQARIAAAAcGAAAEBAgLhJoEAAEGCAABCAAAAQwIC4SaBAACCAgABQYAAAMECAyElgRAgwgIAEaOAABClAgLg7oDgQIMCACEkgAAQaAIC4K+A4BFAAAACAYAAIKICAvDvgOAhAAAAEaOAAFBmAgNA7IDwEKSAAEFGAABgKwIDIGaA0GGngACTBgAAkGyCAzBngNAQAgAAIIeAADCqAgMQp4DQIOSAAFGHAABAbAIDgKCA4CDhgAABxAAAcMcCAxAtALBgwwIAoKCAANDAAAMQLQCwYiWAAGOHAAAwzAIDIC4AsBDigAAR5AAAgMYCA3AkAMAwwQIAUSGAALDAAAKAZwCgQKOAAHDDAABQQgICgCcAoIHEAgDSoYIBAUIAAoCnAKAwwQIAQSCAANDBAALQawCgMOGAAFGDAACQhIIB4GUAkCBCggBQoQAA8IEAAeBlAJBhY4AAskUAAEFIggHgZgCQIOGAAEGDAACwhIICEKgAkCBBAgBAYIAAwIIAATBpAIAQYQAAEECAAJBCgAEwaQCAMAICAGBhAADwwQABQGkAgBBAAAAwIAAA0EIAAWBqAIAQoYIAIIEAAKBBgACAYgCAEIKCABChAACwQgAAkGIAgBAhAgAgAAAAoEKAAIBiAIAAQoIAEAEAAMACAACQYgCAEKEAABChggBwQwAAAEAAgDChAAAggoIAYAMAAABAAIAAQYAAAAEAAHACAAAAQACAICIAABBAAABwAgAAAEAAgDEAAAAh4YAAoEEAAJBCAIBRgAAAYmGAALACAACQQgCAAIAAAAFAgACgwgAAkEIAgDEAAABCIIAA0IMAAKBCAIAw4oIAUMUAALBGAgEwSQCAcSGCAKEHAACgSAIBMEkAgBADAgAAAgAAwAMCAUCJAIBAoYIAYIQAALAFAgFgigCAIEEAAFAiAABQAwIBsMUAkFDBAgCg4oAAgEQCAcDFAJAgZIAAEQIAADCCggGwhQCQIEEAAFAiAABwQ4IB8McAkBCBggAAgwAAkQOCAiBEAKAhIYAAUUUAAFFHggIwRQCgQAQCAFChgADgQoACMEQAoACBggAggwAAoMOCAnBJAKAwooAAMEEAAFBAAAKQBwCwIOGAAACCAACAggICkAgAsECjgABgQQAAIECAArAIALBA44AAMMEAAGBBAgLwDgCwYQYCAHJhggDAQQADIA4AwFFGAgBiYYIAsAEAAzAPAMBhRgIAcmGCANBBAAMwDwDAcccCAIMiggDgQgADkAgA0EGigACxxAAAYCgCA0AIAOAxIoAAoYQAAFBoggNgCgDgQaKAALHEAABgKAIDYAoA4EGigADRxQAAcGqCA8AHAPAQgYIAAEcAAACCgALRI4EAAUGCAAEIAAAAQAAC4SSBACBBAgAAxoAAAQSAAuDkgQAQwoIAAEgAAACCgAMRI4EQESCAADEFAAAgY4AC4SyA4BABAAAQYwAAMGWAAvEtgOAh4IAAYgYAADBigALxLYDgEWKAAEGFAABgY4ADQSqA8ACDAAAQwYAAISgAAwDkgNAQwQAAIYOAAAFFAAMRJYDQEKMAAABBggARagADEKWA0ADCAAABAYAAEYkAA3DugNAAQAAAAIOAAHGFAALgbICwQSOAAEHGAAAxAQIC8C0AsDGCAgBC4YAAkYkAAtBtgLAAQQAAAMSAAGFFAAMwZIDAAIKAABEkAABgggACcKcAoDBBAgCBIoAAwcYAAoCnAKAxpIAAUocAADCCggKAqACgEOKAABElAACAggACwKwAoBBCAgAhIoAA0MYAAdCmAJAAAAAAIAMAAKBDgAHQ5gCQIMICAFGhgADxiAAB4GYAkBBCAgAhIoAA8MYAAhDoAJAQYYAAEEMAAIACAAEw6gCAIKCAABBDAACgggABMOoAgBAhAAAQAwAAgAMAATDqAIAgYYAAIEQAAJACAAFRKwCAMIICADEigADARIAAkOMAgEFBAgBRooAAoIOAAJDjAIAAgoIAAEMAALBCAACQ4wCAMIICAEDigADQRIAAoSMAgCCggABQxAAAcICAAADBAIAhYYIAcYYAAICCggAAgQCAAIEAAABCgABwQ4AAAMEAgCBggABARAAAgEGAAADBAIAQo4AAAUIAAIBDAACAwwCAMOWAAAICAABQQwAAcMMAgAAAAAAARAAAsEKAAJDDAIAQo4AAEWMAAIACAACRBACAMMUCAFGhgAEASAABQMkAgFFHAgCCIYIBQMwAAUDJAIAAAgIAAAQAALADAAFAygCAMIUCAEEhgAEQSAABYMsAgDEjgABRBAAAEEOAAcCGAJBBJIAAYUMAACEjgAHQxgCQEKKAABBEAABAgwABsMYAkDEjgABBBAAAIEOAAfDIAJAgwAAAUOCAAJAGAAIQxQCgIMECAFFggACgSQACEIUAoBCAAAAwYYAAkMSAAiDFAKAgwQIAUSCAAMAHAAJgyQCgEMECABFDgACBA4ACkEcAsBEBAgARQ4AAgQOAAqBIALARAQIAAUOAAIEDgAKgSACwIUECAAGDgACRQ4ADAE8AsBBggAAxRwAAYYKCAwAOAMAAQIAAIUcAAGGCggMQDwDAEGCAADFHAABhgoIDEA8AwCDggABSCAAAYcOCA3AJANACAgIAEoWAAFEDAANQh4DgEWICACHFgABRAwADYImA4AKCAgATJYAAUMMAA2CJgOACQgIAEuWAAFEFAAPAhoDwEEAAAAGEggABh4AS8mMBADEBAgAChIIAAgiAEtIkAQAQYYAAAEWCAAFFgBMSpQEAEIECAAGGggAByYATMqMBECDBAgAhg4IAEUGAEuGsAOAw4oAAkEAAAEFugALxbQDgYgICAENmggAxRIAS8e0A4CEBAAAyBIIAIWOAE0HqAPBAo4AAgMECABBrAALxpQDQAAIAABCDAgAgjwADAaUA0HFigADhQgAAICcAAuGmANBA4oAAkQAAABBLAANR7wDQEEGCAEBjAgBxjgACwi4AsCAhAgARA4IAcgEAErHuALAgwYAAYeMCAEFMAALSbwCwEEGAAEBjAgBhzwADEmUAwADCAAAQ5IIAUI8AAmKqAKAgQgAAQCMCAEBNAAJS6gCgAUEAABHmggCBAgAScqoAoADBAAAhJYIAgIAAEqLuAKAAAQIAAEICAMAMAAHS6QCQMCAAADACAgCwDQAB4ukAkABAgAAAgQIAsEuAAdLpAJAAAAAAAAICAMBNgAIDLACQIIAAACCiggCgTIABMq0AgGCCAgBhIoIAsI2AATLtAIAgYAAAEAICAKBNAAEy7QCAEIECABCiggCwTYABUu8AgCChgAAxAAAAgIqAAKKmAIBxY4AAokEAAFDJgACiZgCAUIECAGEiggCwjYAAkuYAgBBhgAAQwAAAkIqAALLnAIAgQQIAIOKCALCNAAACQwCAcUMCALJkggDxAQAQAkMAgFFhgACRgQAAcEiAAAJEAIAQAQIAEGKCAMBNAAAChACAEGGAADABAgBwiwAAooYAgFCjgACgAQAAUIkAAKJGAIAwAAAAYCQCALDOAACSxgCAEGKAACACAgCAjAAAoscAgCCiggABAgIAsAoAATMNAIAQg4IAUaICANBIAAEzTQCAICICADAEAgCwDgABMs0AgBCjggAQ4wIA4EwAAVNOAIBBgAAAUeSCAFBOgAGyyQCQIQAAADGkggBAjoABwskAkDGAAABRpIIAUI6AAbLJAJAxQAAAQeWCAGBPgAHzDACQMOGAAGFBAABBR4ACAkgAoCBhgABBAAAAYUiAAhKIAKAg4YAAUQEAAGEIgAISSACgIKGAAEFBAABxiIACUs0AoBEAgAAhogIAkEyAAnJJALARAIAAIaECAJBMgAKCSgCwEQCAABGhAgCATIACgkoAsAFBgAAR4QIAkI2AAtJBAMAgAQIAIEYCAIBCgBLyDwDAEAAAACBGAgCAQoATAgAA0DABAgAQRgIAkEKAEwIAANAwQgIAAEaCALAEABNiCgDQIeKCAHNFAgBgwwATYkgA4CEjggBiRQIAgQMAE3JKAOAyYYIAlEUCAECDABNySgDgMeGCAIPFAgBAgwAT0ocA8CBBgAAAgYIAA8mAA0ZsAQAQwoAAAEMCAAQLgANWrQEAMAAAAAEBgAADh4ADRi4BADBAgAAAgIAABEiAA5btARAAwYAAYIICADLHgAM0ogDwIMECAEHGggBSjYADJKMA8DHkgACSQQAAAwKAA0SkAPAhI4AAgQICAALHgAOVIQEAIGECAFEEggBwiQAC5CoA0GBigACgAwIAMEYAAuRrANARBQIAAgaCAMDMAALj6wDQEKMCADFFggCgygADRGUA4CCAAAAgo4IAMIUAApSlAMBAgwIAcOSCAIDGAAKU5QDAEOMAADDCggAgowAClGYAwBDBAAAQ44IAIIUAAuUtAMAg4oAAMUECAECDAAJU4QCwQGSAAGDCAgAQAwACROIAsBFhgAABwQAAcMAAAmTiALAg4oAAIUECAGCDAAKlZwCwIEECAEAkAgCwhwAB1SEAoCBDggBQYwIA4McAAdUhAKAQgAAAMKSCALBHAAHVIQCgEAECADAkAgDARwACBaQAoABBgAAQwwIAgIeAATUlAJAQJAAAEMQCAFEHgAFFJQCQAMKCABCCAgCwBgABNSUAkACAgAAAgwIAoEiAAVVnAJAQYQIAAIWCALBJAACk7QCAEIQCABGkggEAygAApO0AgCAjAAAQxQIAUIeAAKVuAIAQoAAAAIWCALAKAAC1bwCAEEAAACBjggCQSIAABQsAgCCkgAARggIAQMWAAAULAIAxRAIAQmSCAPBLAAAEywCAEEECABCjggDASIAABUwAgACAAAABAoIAoEeAAKTNAIAxAgIAQeSCAPBKAACkzQCAICMAAFAAAABQwoAApM4AgACBAAABAoIAoEeAALUPAIAARAIAEICAALADAAFEhQCQIGICAFCAgACAg4ABVIUAkDAFAgAwIQAA4AIAATTFAJAARAIAEECAANBDgAFlBwCQIeOAACJBAAAAQYABpMEAoBEDgAAhoQAAIIGAAaTBAKBCI4AAUsEAAAABAAGkwQCgEaOAACJBAAAQQYAB1QQAoBBBAgBA5oIAoMsAAfSOAKAw4YIAIEMCAKDHAAIEjwCgIEECAHEnggChDAAB9M8AoBBhggAgZYIAsMoAAjUEALAxQQAAIaWCAGEHgAJ0gADAUUEAAGHlggBwiIAChMEAwDGBAAABxoIAcUiAAoTBAMBRgQAAQiaCAIDJgALVCADAMGGAAJDAAACgAQAC9EYA0DBhgACggAAAoEGAAwRHANAwYYAAkMAAAKABAAMERwDQMGGAAKDAAACwgYADZMEA4AFEAgARwYIA00QAA6UAAPABBAIAAQGCANMEAAPFAgDwAYQCABJBggDTxAADxQIA8AFEAgARwYIA04QABCVPAPAQQwAAAUKCAAVHgAPYawEQIMMAAAHAgAAFg4AD2GwBEBCDAAABRYIABYuAA9hsARAggwAAAYOCAAXIgAQ47AEgIEEAAEGBggCjwoADhe0A8AEBgABwQgAAlESCA5XuAPAhAQAAQsOCAJOGgAOVrgDwIEEAAFIBggCTwoAD9iwBACBjggCQAAAAscSCAuSjAOAgZAIAcMGCAMDDggLkpADgEOSCAKEBAADCRYIC5KQA4CCkggCgQQAA0cWCA0UvAOAw4oAAMQECABEEAgJ0rgDAAEKAABEAAAAQRgICdO8AwFEigABhggIAEYICAoSvAMAw4oAAMUECABEEAgLVJwDQMUAAAFFkggBxAQACNWsAsCBhAAAQQoIAYUICAkUsALBiAAAAkiaCAHEEAAJFbACwMQAAAFFkggCBQQAChaIAwCBggAAwgQAAcAUCAcWsAKAwwQIAUKGCAJADAgHFrACgYSGAAIFBAABwRQIBxawAoCAhAAAwQAAAkEQCAfXgALAggQAAMKCAAJBDAgFFoACgMOOAAFDCAABgRQIBVWAAoHHCAgCx44IAwAAAATXgAKAwwAAAQKCAALADAgFmIwCgEKGCACCCAACwBAIApagAkCBDggBQoAAA8IICAKXoAJBQ4oAAoMQAAGBGggClaQCQMKCAAFDDAACwBQIAteoAkACBgAAQ4AAAgAICAAXGAJAQYgAAEEGCAGAAAAAFxgCQIIGCAGGhAACwAwIAFeYAkBBAgAAwoAAAoEICAAYIAJAAgYAAAMECAKBBgACViACQAIGAAAFBAgCwwoIAhcgAkABBgAAQQQIAkEOAAJVIAJAAgYAAEMECAKCAgACmCgCQIGOCABADAgDAQwABRY8AkBCkggAQQgIAwEMAAUWPAJAwYoIAIEMCALCEAAE1TwCQEGSCAABCAgDgQwABZcIAoBGBAABCpIIAIEQAAbVLAKAQ5AAAIaSCAABFAAGliwCgQgECAHOkggBQhQABxYsAoBFCAABCY4IAMEQAAeXPAKAgQQIAAIKAAHHGggH1SQCwUQQCAFHhggDBAYICBUkAsABBAABABAAAMkqCAgVKALAgggIAESKAAJGFggJFjwCwEWWAAGJEAABRSIICVIoAwDEmgACiQwAAEgiCAmTLAMABhIAAQoUAAHEJggJUiwDAEaaAAHKEAABBiIICpQMA0BCCAgAwQgIBIUEAAwSPANAQggIAIEECAUGBAAMUgADgEIICAEBBAgExQQADFIAA4BCCAgAwAgIBUUIAA3ULAOAgpIIAUgAAANLBAAQFywDwIOWCAGIAAADjAQAEFc0A8CClggBSAAAA4sEABBXNAPAg5YIAYgAAAOMCAASGSwEAEMSAAAAJAAAGQYIEmSwBIAEFgAAASAAABkKABLjtASAQxIAAAEoAAAbDggSpbgEgEUWAAABKAAAGgYIFCa8BMDBDAAAgxoAA1gGCBDXoAQBRAQAAEqSAAQXDgAQ1qQEAEEOAAEBGAADGQ4IERioBADBDAAAhBYAA5kCABJZoARAwZYIAsMaAAVKEggMjqwDgQOaCAOAIAAEzB4IDE2wA4CClAgCBxYABYkKCAzOsAOBAZoIAwMaAAWKDggNz6ADwEEECACEGgABQhwICU2YA0CBigAAwBQAAIQcCAmNnANBAgwIAEceAAHAIAgJDZwDQIEECABEFgABQhwICo+AA4DFjgABSBgAAIMsCAhPlAMAwQYIAIGQAAHEHAgIT5QDAkmaAANOJAAAw4AISI+YAwEGjgABiRgAAMMsCAmRsAMAgAgIAUCEAALGDAgG0pQCwQSKAAGICAABAxgIBtKYAsJFFAgDxoIAA8gECAbTmALAwAgIAYCEAAMGDAgH1KwCwIKOAACEBAABQggIBNSoAoDDAAACBYoIAsYIAAUUqAKBx5YAAw0QAABCHggE1KwCgMOOAADGBAABgQgIBZW4AoBCCAgBA4YIA0MEAAKVjAKAQoQIAIEGAAKBDggCVYwCgQMQCAKFjggEBxgAApWMAoCDDAgBRIoIBAQMAALWmAKAAQQAAEIGAAHABAgAFQQCgEAEAABAjAABwBAIABUEAoCBiAAAwQIAAUAEAAAWBAKAQIQAAIAEAAHABAgAVwwCgAAEAABCigACgQwIAlUMAoCBhgAAQAwAAoIQCAIUDAKAQQQAAQOGAAKBBAgCFgwCgAAEAABChgACwgQIApcYAoCBFAgAgooAAwIWCAUVKAKAwRQIAUSKAANBEggFFSgCgEEUCAADCgADQxIIBRUoAoCBFAgAg4YAA4IOCAWXNAKAg44AAMgMAACGnggGVBQCwQKOAAGFDAAAhaIIBpQYAsBEjgAAygwAAIiiCAaUGALAQo4AAMYIAABGmggHViwCwAAEAACCgAABwwYABtIIAwDBBAABg4QAAcYOCAcTDAMAQYYAAAMECAHBCgAHEQwDAAAEAACDgAACBAIACBQoAwFGEAAAR4IAAsIOAAkQCANAhBAAAUQKAALCAgAJTwwDQYgQAAEJiggCwRoACVAMA0FGFAAABwIAAoIKAAqRMANBQ4YIA8cYAAVHFAgNESADgMKGCALGGAAFiRAIDVEkA4EChggDxhgABYUQCA1RJAOBQ4YIA8gYAAYHFAgO0xQDwAMYCAAADAAE1gwAEhkcBAAFGAgAAg4ABNUMABKZJAQAQZgIAIMMAATXDAASmSQEAAQcCAAADAAFFwwAFBsgBEEDFAAACSIIACUmAFYvgAUBAxQAAAkiCAAmIgBWcIQFAQMYAAAJIggAJSYAVnCIBQFEFAAADCYIACkuAFfzkAVAwJgAAsEWCAPgAgBUH5QEQQGaAAMCFAgEIT4AFF+YBECBkAACwxYIBF8CAFQfnARBAJgAA4EWCAPiPgAV4ZgEgIIgCACFFggIDz4ADlOMA8EDKAgACRoICI4GAE4SjAPAABwIAUESCAeQNgAOVJADwMIkCABGFggIjz4AD5WABAEBgAACQg4IAcYmAAlOsANBgYAAA0MOCAFFIgAJTbQDQICEAAFBEggCBi4ACY60A0EAhAACgQ4IAYcmAAqPnAOAwwQIAIiKCAHFHAAHjawDAMEIAAEDiggBRBQAB86wAwDEDAgADA4IAoYoAAdNsAMAwwQIAMiKCAJFHAAIz5ADQMCEAAFBAAABggAABhC4AsCCiAgBBQYIAoUIAAYPuALBgpIAAkcEAAABCAgGEbwCwQGGAAGCAAABgwQIBtKQAwCBBAABAoIAAcYAAARSjALAQQ4AAESEAADCDAgEU5ACwUMICAKJiggDShQABJKQAsDBAAABg4IAAoYEAAUUoALAgYYIAMQAAAKBBAgCFLQCgEGKCABDAAADQgQAAlS0AoEBhgABhAQAAYISCAIVuAKAgYYIAQQEAALADAgCVoQCwAAEAADBhAgBwggAABUsAoAACAAAwIQIAYMQAAAVLAKAQAQIAQCAAAJDAAAAFjACgAAAAADAgAACQwQAABc8AoBABAAAgYYIAkIOAAIVNAKAQQQIAIOGCALBEgACVTQCgAAIAACBgAABwwYAAhY4AoBBBAAAwoIAAoIGAAJXBALAQAwIAAAECALFCgAEkwwCwEAICAABAAACBQYABNQQAsCAEAgAQYAAA0YGAARUEALAQAwIAAEAAAMGAgAFFSQCwIGEAADCBggAgAgABhE4AsBAhAgAwQYIAQEKAAZRPALAwYgAAQMGCABACAAGUTwCwICIAADAAAAAgQIABtMUAwEBCgAAgoAAAUICAAbSLAMAghYAAEUAAABCBgAG0jADAYAAAAFBggABwQIAB1IwAwEBBgAAg4AAAcICAAgUEANBBKYAAosECAKADAAIkigDQIKaAAGHCAgDwxgACNIsA0GFqgADjgAAAcIGCAjSMANBBKoAAosECAKBDAAKFBQDgUEYCABClggJEjgADpUAA8FAEAgAQRIICE80AA8WCAPBgBQIAQGSCAmTNAAOlggDwYEYCACClggJ0jgAEFc4A8FDmggDiRAIBNYwABVgFARBRJ4IA80QCAUWMAAVYBwEQQKeCANGEAgFWDAAFeAcBEFEnggEDBAIBRcwABeiHASAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAP/bAEMAAgEBAgEBAgICAgICAgIDBQMDAwMDBgQEAwUHBgcHBwYHBwgJCwkICAoIBwcKDQoKCwwMDAwHCQ4PDQwOCwwMDP/bAEMBAgICAwMDBgMDBgwIBwgMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDAwMDP/AABEIASMCBQMBIgACEQEDEQH/xAAfAAABBQEBAQEBAQAAAAAAAAAAAQIDBAUGBwgJCgv/xAC1EAACAQMDAgQDBQUEBAAAAX0BAgMABBEFEiExQQYTUWEHInEUMoGRoQgjQrHBFVLR8CQzYnKCCQoWFxgZGiUmJygpKjQ1Njc4OTpDREVGR0hJSlNUVVZXWFlaY2RlZmdoaWpzdHV2d3h5eoOEhYaHiImKkpOUlZaXmJmaoqOkpaanqKmqsrO0tba3uLm6wsPExcbHyMnK0tPU1dbX2Nna4eLj5OXm5+jp6vHy8/T19vf4+fr/xAAfAQADAQEBAQEBAQEBAAAAAAAAAQIDBAUGBwgJCgv/xAC1EQACAQIEBAMEBwUEBAABAncAAQIDEQQFITEGEkFRB2FxEyIygQgUQpGhscEJIzNS8BVictEKFiQ04SXxFxgZGiYnKCkqNTY3ODk6Q0RFRkdISUpTVFVWV1hZWmNkZWZnaGlqc3R1dnd4eXqCg4SFhoeIiYqSk5SVlpeYmZqio6Slpqeoqaqys7S1tre4ubrCw8TFxsfIycrS09TV1tfY2dri4+Tl5ufo6ery8/T19vf4+fr/2gAMAwEAAhEDEQA/APur9v3Q11/9jHx/GyB/sdlFfJ7GK5iYn/vndX5BnUf7M1CSZflaDbMmB6YYD8wK/ZL4yeLtN+IfwY8UaLbhrg6xot5bo8bxzIGNu7LkqT3UV+N00Tar5TFQsxQBsDjBHavsMRTcGnI/PqdRN6dz9i9QuVvvFv2xG+TULW1vFI/iEkEbZ/Wuw8Nnay/yxXl/wt1P+3fhJ8LtTHP9oeCdJMh/vSRxGJz78pXpmgt8y/n1r5ytHlquK7n2dN3pp+R3mnkGJf8APrWtaj5PwrH045hrYsW+WmZtE8YyKfjihO9SdQaBEbpg0xhk/mfrU5XNRuuc5/8A10xkDJnion61YcZXt9PWoZBjP+cUikQSD+lMPBp0hwfwqNzzUlWGvyfxqvJz/OpnO7/69V5mxQAxzzVads5/PmpXfb/nrUEsgAP+c1I0ZuqfcP51zWNviPT2x/y8r/Ouj1E5Rq5u4bZrFm3/AE3Q/qKqO4pR0PwV8deHLe38Ya4y2sMLRa1qttLI07bVeOSEI2AOBuuosAdWB7ViR+CL6XRNSkkg2y2YhnCeai7leQDc+4japXJBzyQBwSAej/aI1i+8F/tOeNkhkjVbPXL+CNJII3jCG4ZuUYFW+YBskZyAeoBHF6r4/wBS1e4mF09rcedIiTSPEP36LudEYfdKqeQAB9xM52riYtKJ5M0uZ3Na90K+0HwFrYu7Oe18u8sCVkGMFVvBjPQH96MgnIzVXQNPafRo7ewhkuLiTTpbycw263Fxc7J0jeNNwJCxxsXYDGVVyf4a1Nc8b3PinwFrEd7N501rZwSgxuPLdRfQrkoB979+ee+TwMnPEWPiC9sNDubNY7po9QAlWNWO0sv3ZAoGS45wwI75yOKrZ3J0vcld77wlr+rWq3UiXNlcS20n2eV0y0bEHGCO4rcs/HeqjwFdbtUu7h472IKblvtGAVfI/eA//rrib3UrqSfz55ppLhgP3h4kyOBk9cgDGTzWzodvLqXha6t4Y5JpGv7ZY1RdxyQ4HqO/fiuXVXQRjqdBoGvS68Ps0kOj3V1IrNHC+kxK0wAyQpiEbZxk9RgKTVLwzq1lH4gto5NIgtZJI5mje0unKMDbyFWAZnyCDwd3OetQ2fijWvAOlzLZPp8b4mMs6hZJPLVxFICQ2VVsFeQH2kkEA5Of4b1iTX/GUmpKs3+j2s0k0ks7XDZ8pxlnbnBJAAOccDJolJvRmm+5D4T0/UL23juNNVg2TECsiowYJuwNxHQcnHTGeOKkS61YaL5qSalHp63PkylJHWPzFAIDAHG4FhzjI3gZ+bnH0PxDNZaNb2sPyiGa5mV1PP76GCMr9AIFI/3jW9p/jSXxLf2EccMNrdeaIUlWXbEkTTfaJMg9CX385wEYLglQ1Z3TJsnZEVsbiWM3L/aZLdZfLSVt5QMeSoY8ZJJOO5OfetTQ/FOo2F8Ps91Nbs8eyYKQVkA6B0I2tg9NwOD0wanm+Kcd7ffaIbWSGdPMWGQOSChMvlnLHKBTIG2qMsVGW4AGXdzwvdwzR7l3x/vcjlWG0HDd84z/ADqJb6EyikzrbbUbzTptL1S92X22eG4ETNtRkVw/l4GAobaRgDjk9aZrd1L4kvbvVAvnRlY0dJukoSFVkJPbcdzZByC2RyKz7PWrXVNPa3M0lgsZjVWm/eqwUkDouVZTI5AHBHHYZvRQwr4U1ma3V1t2udsPmfMwDMhQHtu2qc+pzQnpcfKhltrnm2bWNnbyKbkrlml8xiFywAAAHqcn37U3xTolxYwyRzQSQzSRedET1dDnkdiODznsao6WlybmSO1YrJNGyud4XKZGdxbtkDvzW/BNcaNo1tb30a/u74zQROgbbGECSEDkbWYRdOGMTdcGsun6i5dDH+HzXTv9kt5PLudyXdsiJukZon3HA7kruwB17Y4q/r3iAax8QdHeOazmXTrZi5toikEUfmyyEhcZwBIN3qxxzgUlhp0s07X9rJbzXlwpky4y0DxqGlxngtuZdnsSeuKk8Yprmsrd3V9M/nadavPeo8axF9hT99IFAEjbZcBm5yjDqclPRWKeisyTRdQtdU0ltJ1zVoYbSBvtViWdnjUfulaNiisy5j3lVxwy8gB8m5b2ljpPjewhsxDqGnvORCshW4WdArEZVgfvccEZBOcVyNx4VurC+htl3TXGWWSKFWLRuAhYdOcBwMjjOfSpNYtpY9Uht5keNoeWRl2lc88j1xUSb6k37rY6rVPAgk8LW9xNuhhjhjmvZUwYYZDIsTRADnKlw5AztUOcYWtCXwnd2PhC5toWhNtgSSeZtxblQ26RSPQbVOPviRfYjm77w5I2ps0KyE2tsbiJANw2RojSOWzwQJCRgdvcZ3r/AEEeI9I03y/7Qury7la2H+mxeUZS67VKFt2GYg47Hn0NCb6A7Pp0ORl0ddM1CO1njZpYZjDJkFlRwxBUn1BB9+K279Y5LyRl+WIttjC9AvYflVKDQr7VPEwjhma/eaQjiQtlxGZCzE9/Ly5J5xmtKOwudOW3xHJIz72WJeXwpIZtvYZVhn/ZPpQk9mZ8vY/RH/gkfp0v/CifFtwI/lm8SRWyKg+6sOnwY/H96Sfcn6V9Y2kEpP8AqZOT/dNfkLrmt3dr+w/4La3kuLaTUvGevXRMcrRlhHZ6fCMkEE8qefesb4i/E3xBYeOdUS18Q+ILOGO7dVSDVLiNUAYgAAPgYx0HFfSZfw3PF0Y1oVEua+lr7O29/nsdDzeFCPJKN7W/HU/aGGORT/qpB/wE81YVmA+4/p0r8Sbb9pDx5pY22/jvxvbqv3Smv3f/AMc/Suw+In7VnxE8P+IfKtfiF42t1js7XIXW7nG4wpuON+Mk5JPr1r0f9ScRzKKqLr0f9dTH+36Vn7r/AA6n7Dedn5dufavO/iFqgj14xLuLBQNo5OfpX5L3X7efxhs4gbf4meMlAbALakzY9/mzxXK/tM/tT/EXXfiZb6ZeePPFE9t/ZWnPPD/aEkaTvLCsjlwhG7dv5B4xWtPgnFRqKLqR/Hpby/Ur+3KUotxiz9atY+LXh7wMm7Wte0fSccsLy9jib/vknP6Vw3iz/god8MfCmnPc2+uSa0scvkH+zrWR1D7d2MuF7dxkV+SOreLLh/FWquWJb7XMvHU/OwHNbz+Kpk8GaXHu3faLq5Zh1+6sSjHPua9yjwbCKTqTbv206X8zhqZ1N/BFL1u/8j9C77/grLaajrFtZ6D4Tu2+1Txwie/u1jADOF3bUBPfOCa8l8ff8FPPihr93cR6bdaVocKsQptrJZZcZI+9LuH/AI7XzF8OPE/meL9JG5mb7UjHB445yPyzz6VQk15nuJP3hZnOck8fl+A/OvUw3DuEpTt7NPRb6/mefUzPESjvY9zn/aF8fePvDPiWXXPGniS6Q20EMaG/dI1Z7uFuEQqozGko6dCRXmtxumuWLXEz/wAW5mxnk/j6fnUem+ICnwv1JsfNNqllHuPcLFdsf1ZT+VY6XbS7W654x2+v6/r7162HwsYc0YJLXovJHm16kpqMpO//AA53GtXUdn8LfDsCLtNxe312e5bPkRA/+Qa+lfC0H/CK/wDBNXwqGbDeIvHuoXRPqttaxRj/ANG18t+I5SnhvwvHlcfYZZMNwvzXEhyffgV9UfEeGTTP2DPgHYBirXf9t6u+R/z1uY0BP/fqvJzbajDvUf4Kb/NHdgF705PpD87I8yDrcS7d23jvz06//rr9Pv2C9D/sn9mnwHD82bm1e5Oe/mXMhz+QFfltbKxdmwq7V6564r9cv2UdH/sj4O/Du1K7fs/hvTHYY+6z2qTH/wAekNfO8TS5cNGPnf7l/wAE9jK43qv+up7FKdzMcd6hkz27+lSSN/KoVPzGvy/zPrrCxgs3v0zS69P9n0q6busZ5/CltxvkFVPGtx5ehTKuPmIXjvk1vSRhUPKPF5zeQqOdsY/ix1OaKTxR8+tSj+5henoKK8uvd1H/AF+o4X5V/wAA838Mf8E9fDumfHLS9a0vxt4y0R7e+jmbQ1+zyWcsZyDC7iNWdGXd94lhnrX5eahp82l6tc2coxJaTPbuvdWRip/ka/X74TftsfDn4o+NdN0HQtbkudZvixggaynXeUUuRvdQMhQTye1fl1+0p4c/4RL9pf4iaagYJbeKNRCA44RriSRQP+AsPyFfrWLo1KdlUi11V1bTuvI+HVeFXWLv0evXt/wD9A/2TdS/tn9j/wCEt0GDfZ9OvdO+ghvplAP0Fe06C2Avavm//gnnqjat+xNo6k/8gXxVqdhx1UPHb3I/WY19GaC+Il69a+bxcbVmfXYOV6ETv9JbNuvfitmw+9WDoL4t147fnW9YP+8x681kDLkYx+VTBcCo1HNS44oYDTwKa3B7/hUpXAqNl2scbutICF+KrzNirD8e4/nVO5OB+tBSK8z4NQySY7//AFqLmXy6pT3m0/jzSLLLTYHXvVeabFV5b7jk/lVae9AFSIsSz89s1WkuKz7nVVDYU5xVY6tkH6UApK5bvZhtPJrmtSlEd9bnp++Q5/4EK0rzUNyHmuY8Q6j5Tpg/ddT/AOPCiO5Utj8Rf24LIWX7WXxKtT5O9PEd6y7GBAUyE4OOhHIIPcV4zqjf2dO0Zk3buRg8DH/669Q/4KB3f9gf8FA/i9bsA0Uvie7Yj/eYMDgfXH4V47rWox6pDIrOGmt22kDqw4wf89z71ndONk/6/r+keTVj7zXmdJpFyo0TxJGrNzpKD8r+zb+lHhLxdax6NfafdG4t5tRs3077dGof7NEZo51GMZKmSMI4HPl8AjLZo6LZ6j/Zvl2Nmt5eeKYv7Msot2CzmWNtx74BiYYyM4JzxXsHxQ/4JKfF7wP4Dj1K38TaTea4YftMmlxWYiEeRnyVkz8xA9e/FcNbMKVJ8snr82exgsjxWIhzw0Xn1PGPHk1jPcQ3GnXUk0KQx28wmIWd5kXDSFf7jYGPQYB5zWz4A8Zr4a8KX115JkubDU7G+tNrBVM0ZcqJeCzRnHKBlz6jNeVw6nqum6xdaP4isZtL120JM1vPA0TN23AHtnuOK6jRnkfwJrD8bVmthuGcrzJzmt6dRTXNB6Hn18NUw9R06iszppfiLaWFtC0Fgy2eBFJDI0UsrgdHWUpuR8nccfKXG4g5IOx8OviVbtJrCLaiYwafOEllgRZkjDBkBZWUscvIxIK5L4GFVQPJri72/IT0Ykfj/wDqrd8B3xjtNfkXb/x5kDJz1dB+VPnd7sxXdD78G41+4eNZbxR++lnEPlbWPLEqpKqMk/kagtJmRNixt5qOWYBDnZgcn24OeMYwakt/Eo0vTUVNzzLqUF+SmArLEkilCPfzDx0xmrPh7xtp4u/tF7dXNjN/FLEm/wA2ETljCcH+JJG65/1MY7ms+VdRKN9TTlt7dPDtjtii3sDM0oB8zl2QKT/dwmQMdQx7nLrV4ZdR8mZ2WHyJQhVgMSeU5i9sGUR545XIyOozJNTfV9AsobNoBb6WJQ6g7GdfMYpIQ3LEqxAP8JDAAZ5g0zUbeNJpJo47mdpFSKJiQqgKS7ttIJ6qqjOCWYn7oBT3TC2upuCaG21Z1ictAFVgzNzkqCfyYn06Ctqx8QXFv4burXy0+xTXMcgkJIYsA+AuTyMHnjsPWsaG2tx4g0mOxtpFmYRtMk75jmkZ8gL1O0qQp9SOnJrR8W6smkwT2b6quoyWpaMxtlpBclsyO+eFZMeXgE8g4JByV01K5GH9oNbTF08tgy7GSRNyN3OR/wDXrWtfFdxrsLR3jJNtCpb7QIvsIGAFiCjaseODGABkA8Hk83b6hHJYrIyN5cYI3FflZvf3711XwV+Eeq/GHX7qSCaHTdI08CTUdRkQslsp5Cqo+/I3ZBjPcgVzVpRhBzk9P6/r5jo0alWahTWr2NLw6sOm3ObiSATWqGb5yQjrKiI8eR/ENq7enJb2q14w1NvE1vL/AGRJG1rrGdMuoTFltwaGRYV3ZbGI4yHz8xDjgAg+xfBr4F/D/wAeahr9jH4b8fXEmgx28jX91rVtF9slaRiqrCiBIzhNwBkk4BBYEEVc8S/sR/2xqB1DwZqsjX7XpvZdJ1h0WV3GQPLliABALvwV/iPzcCvK/tzCyfI2159D2KnDuMjC9k/JPX/I+e7PxD4gGu287S48uGTaGjQ7o0l/eMy+vmRnk8nYB0FVk11fEHii8murW3kmlmMpmjDB95dS2TuwQw38Y4J4wBiun8eyX3wy8f2th4k0KRLy0hlhkMm2Np0dpGBHy7XUNJuxnDEHJG445y48T2uvawtzbrcKsMQRmliWNpyrZBwrEL8px7BcZ5r0oyTScZXTPFqQcW1LdbpnY3MFpB4r0zTV1KOPSb6RReGKSOOaJN21QZNhO0I+QjZ6YJ4BXndJ8N3V2W1qykjhtYJVvIUMoE0bny8bWwMuCyDgDkZwMEh3iPXLXQ9f0XXI4Y5Fiu1uLmBITG8o80OV3Y2n5RheePpWf4OPh+x8MR2c+pytIr/vZDFIhdQuEZV28LkneMgjqpYgA1zakNXkaFxd674ftkhuL7dGxnt0RIR8oCyWsh3bcncnmJuySUxyBtw648fSPZXT6gq3ssytbPOhEVwqSsWcI+CuSzOxJUkmSTn5qzFtrZ9NaPT9UmuIZB58lupLRxhIg0g3MQ3DeYFJByAvJzk5NxLu0t2kkCzNKDsx90k5HSjma2Ik30PaviUkOn/ssfBWzVpWiur3xLeR+e4aUqdQgiXcy4BP7s5wAK84+JF/v8caw3P/AB+Te+AGP6Yr1H4p6hptj8LvgDpV/pMt/NJoF5do0d/9l2ef4gvounlvuyYM546Yry3xRr/h3Udd1GRtG17Mk8jts8QwLuJJ7GwOPzPSv1jhnmjg6VovZ9usvU8rHR/eS17d+3oc2b7e0gYkhQT97ocHpXS/F+6x4vvI2J/d+VDwQMYiX0rNsLvwrcXkMf8AY/ixTORHx4jtOCSB3033rb+KGueGb/x5rG7TfE6sLllJXWLVkwuFOF+xj07k819Nzy9onyvZ9V3XmcDppxumt137PyPPryTbaLtG35jnt+VQ/HE/2j+0zc2rAbIzpFme+3FnaKf1JroRJ4RlaONofFv3xgLcWknUgf8APJfWqfxP13wuP2svEhfSdcvHs/EjQl5NWihiVbZxGT5a27OcLDnHmjpV1K0vaX5X8L7d15mtGnaL17fqcdDc/aryWY4Pnuz8j+8xP9a3tXvltdA0aNnRCUuXAYgZy4GQP+A1R0Tx3Y28MP2fwv4cj2qMB1ubrGB386ZwfxH4V1et/FPWNN07RFsZ7XR/M08zOul2UNiuTc3CjiFF7Iv1/Gu2U5tpRj978n2uZOMVe7/rQl+FGhapeeKrEwaffzKizSboraRwAIZCOceoH+cVc0v4U+ILk+ZPprWsYA5vLiKDn/gTAj/61Zvhbx5rOpPqzXGqanMI9MnP726djuO1fXHc1ixSfvRn52zkluefTn8PzoXteZvRaLpf9UYyjHlVz1qTwB9i+GsK3WteG7RrjV5HDG884nybeHONgPI+0DOBnkfSqeneH/D1l8914ma63Yythps0hH4zGMfka5jVLxrPwD4ftgV/ePfaiCDjPmSR2/8A7ZVFZXLtGvG4t0HT2HNZ06U7NuXV9F0fnft3Mqkle/L083+p6940/wCEN0i40qGePxdeNa6RbDy4ntbIHcu7lmWYg5bkbetfVn7RGpeFdB+EvwU0e+0DxDdJaeCobmFYNfhga2WeeR8PmyYSNzncFQf7Pevif4kXXn+PbyMN90RxcHoFiQf4j8TX2J+3gjaV8UfDmjqOND8FaHaFQPut9kR2H5sa+azCinXw8W3tKW76JLp/iPTwdS0KsrLotv67HCLqXgF7eRRovjiNtpHy65ZzHJHvZrmv1y+HunRaTcW9nCrRw6fbpaxocEokUaxqOmMgKOgA9hX43/DvSzr/AI90HT1XzGv9UtLYAjrvnRMf+PV+zfhOTzdcvZR0LSEcer18xxVFQhBK+0urfbue1k/vSk2uqOjdsCot3rRK+R/hUZfI/Gvzk+mZatDmVelY/jmUDT7ePp504z7gCtW0OCfYGuf8cXGLyxj/AIVDOf0/wrsoqxy1Hoeba1O0+pzv8vzSN1+tFV7uRpJiT3Ofzorx5RTdzojsTWn/AAR3vPhB+0J4X8X+Cbrw3DouhXTXNzaRwz29zOHikjZFVndMAPkfMDnPtXwV/wAFGvhndeF/20PHizW72/2q8huMMu05ktYXP6k1++SsHHFeZeI/g74F+NfiPxXpfiDQdH1ySO4t5Llbi3DSRM1ugX5sZB2KOh9K/Qv7crVoKOI1UFZW3te/5s8WtktPmc6Ojk7u+17Wv+CPzM/4JmM3/DNXjGxLbvsHim2vUHoJrRYifzhFfUOgHKLXosn/AAT98E/s9fD/AMaXXguO+sF1YQ3b2kk5mhjaEufk3cjIc9+wrzrw+m1BXHiK0as+eHl+R2YWjOlTUJbnceHnzEPb/wCvXQWQ2yD3rnfDo+X2rpLNP3i1mUy/EuanRcg02KPKirUcPH4UgITHxTWhzkVa8nIptyqW0TySOsccYLOzHhQOpJ9qXQFEzZ02jv7VQuiQM1+c37d3/BwBYfCDSdW/4VnocOvW+n6g2mR6zdSFre6nT/WCOMAHap4LMecjA5zXz38C/wDg6h17/hNbeD4jfDvSdQ8PTMEnm8Pytb6hbL3kSOQlJcDnYWUnpuHWolUinqdVPC1JK6P2Iv5etY93dbP51zvwy/aQ8D/Hv4LWXxC8H+IrLWPCF/A0yX6Ex+SVH7yOVWwYpEPDIwBU+xBP5tft7/8ABxfo3wW+KDeFPhf4ZtfHX9nsV1DVptQ+z2e4fejj2ozNtyMucKDkc1fMluc6o1Jy5Uj9M7zVljH3qz31vzx97171+Nviz/g4z8efatPvrj4O3Wl6AExdTfbpT55PV43aFV2jqARj3r7o/YM/4KL+Ef23vh8up6HNNbX1vMbe6sLrYtxbydgVUkYIwQQcH8KmNSE/hKqYatS1mj6X1DWY7KF5JpY4YozzJI4VV+pPFc94V+L3hzx7czwaH4i0XWp7VissdlfRzSRkdcqpJFfOP7QP7PGmfty/DbUNe1XxNri6PcNdWGj2ul3Zht7NIZWheZgv+slaSN/vcAYAHWvxJ/aC/Z+8afsCfGWKXS9Wvo03edpWu6Y72rvtb7rbTlJF4ypJU54JB48+WZQ9p7Nf8OerTyOq6Ptm/Xy9T+liXWfvDP1zWHr19viZiff618cf8Ej/APgo3e/tsfAW6s/FU0Mnj/wYYrfUp4wE/te2Zf3N4VHCu2CsgHG5Q3G/A+ndc8TKYG+bIx+Vd0JJ2kjyalOUG4s/GP8A4Km3q6Z/wUV+K38P/E6Sc+xe3hk/Hh/1rwjxTEuhalBfXVwljb3Cq8Zkb5mHGTtGTj8K+vf20PhIvxR/4KWfES6Fu2pTzXOkw6bpqg7tSvJ9Ntiq/wC6gQu56AYr3K7/AOCHPgPwbZXGofEfVdU8YeNJFV76CzuTa2WnsVBESKh3EKMLliBkcAV5OMzD2ekVot359l+p6uX5H9ZfPVdr7f57P+up5F+wx4Xtfin45/tnwDN4L8Vat8L9Hj154NRuJDGJBJGnyQR4eV1Tz2C7lUMcsTnY3sfjf9rr4g6XP4m1XxD4V1HWtN04zXKRafNZma2too3kkuQA4VrZAAGLMsgMsYCuTgfHf7Vv7K2vfsG+K9P+LPwgu73SY/DV0tw4gdmlsF6EvknfC2AHByCG5HevZ/Dn7TviX4x/AU+NbLSNSt4/iF/oN4dFktpcmJ8yx+S6gKwfcPnZQVkOM9R4lSrCdP2sNtb3776/1Y+yweFlCaoPRpK3mu54N/wUk+Mw+LekeF/Ekujf2brmh30+nSSKHUNGwysbiRUbO9DgqGQgkgivM9J8eNF8PdatY/LgjaS2tuBnEeZGOT3JI6gV6x/wUp8aR2P7NGlaG2nPa3t1qVtEvn3AkeNIw7khQSFbhASpIwTzzXzj4c1+1h+GF7cXgm8xnt32oufMYI/ckYyT74/SvUyWX7h8vmfKcUUv9pilq7fnsO1bxVDFIjySCFe25sZB/KtTwv4nhm8J+Jnt5lYJDbR8HncbmPP/AI6DWJ8Dv2VvEP7Uc811b6ppliMsoafLHK8Y2gjbnt7A1heJ/gD4i+Gni++0e9DWuq2aNNbKAdl8qk7vLbpkYJx7VvLHUVNwctVucFPI67gppb+n5bnWWfiDglpG245OOn+f6mtK90a60m6SK9tZrORokuFWVChZHAKP9GU5B9Kwfhfq8HifR2vJrKO+kW3khMTMVxIF6jBHIGGHb1rI8ffHm68Ta2P7Pi8iOGFIFnmHmM/l5HTkDg+9V7Sbq8i+f6fkctPLb0HVb1vZL036eaPQb910yK1ZuI5t20Z5BGB/X9PernhSezug+6ZlbIAcpnt0Az/WvE/+FqapLcQtdy/a1hG0K4C9+xH+elekeC/FlvqfgW+voYZVaO6jjLZHBKsShHXPyghuhzjr022ZyVMNKmrs9O0r4j2ugeJUaG3gkm02FmgnclibkKTGSvRVRsNjDFtm3IDZXjbXU915GsjNIvmKGIbduBPPPqa5ltdePUDKCr8s211ypcoVVvqu7cB0yBnIyKm8MLdSlpY4JpIbaRA0i/dQ54yenOO/pRe5ko2R7FbXGgWfw5j1K+uL1Y1uHzbWoG6XAzt3Mflz0zg1+gnhz4H6P8LPg78PPDsduLWTUdKfWNSCfN5l2UBdSepCOzr64iXuK/LXxBqzS+HZLBXVeZQvoGBBH071+htj+05Y+NPAPg3VI3uGnt7Q3wEZ81ljuIis0bjtiQyEMMjejg4OBXk5tHmhGL2PcyOFqsmt7af19x3Xwxnh0i3m0eztYvt19dl5pLq3MqhCh+dV3oG2bGQgthCT2ra8R/ApdZltdS0fVNS02+WZZUVlhkhuAO+1OYs9jndjFb3wK8D3HxG8A+G9UvZoI7mO1mguQbdjMj7ykM8TDgq0SxBgwGCztkknPsM3gj/hDfhzPb6Pt+1RwH97IgaQnGCeR94+tfD1qMZ+VmfpMcHyS35rpH5k/wDBSP8Aaesfh1d6f4D8YLNrniS0eLUI9Qs1WOS1tZgQX+ccsVDApkh8KxwVBPmPg7xD4dvvCf8Aaml6nDq2jx6lPG06oVnbFsjQrJGwBVd7KCcdXHGCK9Q/4KSf8E+dX+Pvx+g8XW2uw6cl9pMFosUtsZY/9HjCYVlI+YuWZs9N4x6D5R+D/wAF9X+G/izxJouo3CWl3brCJomkPlSKWba2P+Agj8PQV9dldTDrDqnCXvJXa9f0/rc+C4iy+caksQ42Wyf5Htninxtput+F9Psd01tbxrIzyhS670LMsYG3lmVsFs8EpwAGzhanfaRPaWa6Xa6o2yZxPLKNsYVlGF3AHncM/QgD1qfwxoelSwC1uvFGh6fdQu0kH2gGWLLGMZKrncQqyYGMFjHzgMR1DeB4UNxY2etRQ6b9sup7axVp5iUeMtBHIi7VbbIIwzDsCR1r0k1LZ3PlZUZwXvK3qjD8J6bpo8MXy3V80OoSB1VGUKkaqNw+YtyWPGO2M1HpFvDp2nf2hdDzFUr5SYJBckd/1r1y3/ZhttXnkuNLWWSPeslvJcWxhaMJK7qrrklmKeVGzDgsGbOCM8D8bfDurfDi1tdHvLeaOFsoZI4Akc7BmxMrKzL8y7QyEhgykglWGNOS0bsxlTsjtvjxcM+tfs8wDbiP4e6BeSd/+PnU769bH1E9eK6tct9vu2zw0khwDg8k/wBK96+PHhhZfir8MbWTWNDspdH+GHhG3eC6mmjmV10GGZjhYmX7zk/e7c4PFeKv4TjnZmXxF4Udj0Iv3xz9YhX7Hw/VjHB0r/yRez6nj42m3Nvz/KyM/wAKv53iHTcfMGu4RgnqPMXv+Pb0qfx3deb4m1Zhu2vqE547jzX/APrVq+A/Bix+MtJ/4nnhWQ/aY+E1Hk856FB6Cs/WPDP21p5Rrnhb947uSdYiHJOe+Pc176xEPa/L+vyOF05pf12Mrwkhv/GWj252t515EmMdd0ij+v8ASuW8Qao2r/HLxdffeWbUtaudx9/tRH6kc16p8HfABn+Mng9G1TwuyTa7p6sq67bF3U3MQIVd2WOOigZJryHwdowv7vVLu41zw7G1zYXU77bqS42tKNucxRuOsg6E9an28JTfp+Z1Yei1Fu3Uh04FV4+o54rqvFty1rf2MIbd9n0yywO4320cxzn3las208N6fBbsz+J9HJIJxHbXjfh/qRXUeO9H0GDxpeRTa1qDeQsEG220YSDEcEcY5e4jzwvpXd7aLmk77Po/LyOecbqxX8J3IXSdakYfL9jCnPHV0zn/AD3qO2kUt13MeR8v58/h+tdF4ct/C9n4U1uTzvEV4qrbwuBa21pkmXtmWb071DZax4Tjk2x6P4jfbjJfWIQPyW1/rVRrX5mot6+S6LvY5ZR0V3/Vyz4sK/2V4dj+75OkqPpvurqX/wBqil0dSb61jG7c0ijOOuTj1/wrf8V6p4chvrGN/D95N5enWhzJqr4AMKyAfKi9N35+lXPBuuaHfeJdLgj8J2AaS4jVWl1G7bb83/XUD86zjWkqd+R9X09e5M4RcrN/n/kWNbsG134v3FrGu6S41P7MuOdzeYE/LtX2L/wUMuRdftjeOokP7nTbiDT4yOm2CCOPH/juK+ef2YtXsfiX+1r4I0+38P6Kv9ueKrRTIY5JJMSXQYkbnOD717t+018VV1/9o7x1dPoPh28WTXLxRLJZ/vXCysuSwYZPy9a+ZxkpvHU42+Gm/wDyaUf/AJE9DDRXsJt9ZL8E/wDMxf2Q9F/tr9qv4e27fMqeIbO5fI6rBIJ2/SI1+tHw9RjazMeSQoJ/WvzX/YI1qy8TftQaNGnhnRLR7O2vLsXEHnCSIi3dAR8+3+PHI7+tfph4CXGlSN/ecD9K+N4urSc1F/yr8We9kkEo3Xf9DYk4FNDYJ9zRN1pu3Lfj+FfCo+iZYt+Fc9sVyPxAutupTf8ATG2P4Eg/4iuvtxtt2+orgPHdzvvNRb0Aj/8AQR/Q11J2g2ctTdXOJnPzfewP50U25GZPvY/DNFePf1+7/gHWpW0P0MUbRXD+Ak2/GPxwyiRo5RYnft+UMImUqD0yMA47bh61tnUPES6mV/s3TGsyTiT7ayuB2yuzH61k/DnwbrWj6pcXurXFsj3FxdzPBbSM8cplkQxsSQOUjQJj8a92pRn7SDWyvf7rI6acoRhNN6tJL70/0/E3/HFmNQ8G6rCefMtJRj/gJr460qPBH8ODzX2reQ/abSWM/wDLRCv5ivjX7N9n1a4j6eXKy/kTXbROOodN4cXPHX8a6azjyw+tc34dHzD6V1lnFkVvc5pF62iyvf2GO9fmP/wU9/4OR/DX7J3jfWfh98KdBt/HHjDQ3aDVNZvZNuj6XMuQ0SBTuuJFYbSAQoYEZODX2t+398fG/Zw/ZI8Ya/aytBq01k+n6a6nBiuZlKrJ/wAAXe//AAD61/MP8aPhXNc6bd6lbQ3N02qTvegAb5Jd7ssK+pZzg45JyT2pxje76I1p076v5H358Cv+Dt/4laNqD/8ACefDPwt4m09GEkz6XcyafcJH0IUHemc9yMCvuj4h/wDBZ74Y/thf8EsPjN8QPhjqd9YeJfCvh+VdV8O6gUh1jR3mxGr4BKyRtuISZMqTgHa3y1+Qv7LH/BKC+1vwtb+IvFl3La310u6LTtmFRSP4/r6V4P8AtO/s0+PP2HdZv5Ib29g0HxVDNpUtzbu3lXluzB2t5R05KqQD3UEV50s0w1Sbw8X733X/AEPefD+JhQ+tOPurV+S8z9XNa/4JJ/DPx9+xl4HuvDXiK9vLzVrW38TJfF/tEaTTxrI6Mp69Qpz124r5V/aH/wCCNkmk+HPtnhHxR9u1aMFjZ6hEtvDMfRJB9w+m7j6V6B+x1+138Uvh9+y74Js9H0HT9c8M2Fjb2Tvc3jR/aDtUb0KqxVdzbee69K9F1rV/iF4+8TGz17WbfwjcQsUvba3Xz0fJIH2bcAXXgEOFJPIIBBFebmFWTmpQdl0/r7j6vKMHS5JRlFSf+f6+h+bHw0/aL+In7Jj+PvhPe6jrnh3RfGUItdb0qSRo/JuEx5dwg6Bivyll4dCMkjGOo/4J4/BbT/Ht74kvtauI4ZNNuopJ7N7Ceeee2gubSVYI9iMENzO8QJPLQ29xtyNxHpP/AAUt/Yu1Lw34a0LxrJcX2u+I/wCzpW167vyqkRx+WUdFUKsYQBxjByGx9PZP+DdD9oqwufih4s8L+JGvLy6k8LSWWkwpYtdRsVlEgmm2glRHHJKgcjCiXHGaVHGKdJy8rP8A4HkzkxmTzw2JSn11j1uuqfmjtfip+0VoHivwld69r+i2mkxzXBshZy7oxMSrkZWeNCgKo/DLj5T2Ffn78EfjrP8AsR/8FDrHW9B/4lvh6XVrb7daPMrwPYTMA+WjJVlQOzqykgbfrX64fHv4e6t4U+GEWjapoOiXNtrN4mrSQRDZMjJIQhjYpydpBALDBHHU5/Hf/gqN/YVn+2Trtnooj+zWNrBbzhZhJskCZZTjoRnBB5FefltaKxvJBNPl1/D+vmd/EGDTy1VW01zWXd7r+vS5+lH7Bvin4raP+w9qVpI7LpPh1NQ0wSO0k1yL9dSciRIwP9WyM7HGc5Qg81y/7SX7M+ofET4VX/8Ab2oaTfWF/axz6W1tbuslufLXLNIzHdufcwIAIDAckV57/wAEv/2/7fX/ABlqvww+IesQeGpvEN6LvQ7vU5oks5/Otoh9lknkyqO3lRtGWPzFtv3sA/WnxX8Daxe/DW88K2l5G11F50sd1K4cpGFLGNBgBj8pwAOBmuXMFUdf2Ud5bfLW515ZUoRwH1iT+Fa/cl+L/M/MP9hn4t6x+wd+0bfeLLqwul0K5sLqwurCaYRS33zAoVOMFd67g5AyuSBivsbSf+C6HhO4mb+3vBut6XpqsFkvoL6OcW+SAAY2VCxyexHBycV4F+0F+x/4n8PaBNrV5pv2hYTFCAzF5PnGWkJ7sBjPocj+HA+VvHGi3Xg/WNS0HUIBHDaTPDcxY5V2WJiD/uMoH4V7WHxFSyi2fE4yjRqyc4x37X08j9vf+CeHw68C/tQ/twD4uaU0WuS6ZZfbtIu1mbyvlsRDMs0B4WRJUsdu4BgUmB4Aqh8Svh94n+LX7b2pa1Lr2jQaDo1qZr63tYBDeYVmy26LG4HKDbJkDaeSTX53/wDBOL9obxp+w18UNB8TaX9sXQ/EFh5Gp2HmYh1vTTIYmZM8ebE33WGCGXqQxr7W/ay8LSfs5fDC+tZr7VtW17WjPqYvrW2U3GyUApDK2QxTYxCyIwK5wQcE152IxSqX5Xte/wCn9adT6HL8Ly2i1ZtJL9X/AF1Pnv4t/tV6vqnxK1bwlq2gLJoV+JIIPOtGKX8JDKwE6korEZwkigNyNwr5U/ZL/ao8Z/Df4Z6x4I8JlZdOsdfuNQhSRQ8caSKqYbP8P7rP4mvZfiP+0vefC/8AZbnj1DTf7LvJIJbW0jmuBcTo7grGCeuSfmx6ISa+L/gRrt34d0/xD5bGHT7pYIL+cpu8mIly2D/fZQ+B3IPvXPl9CdWnUl35V5Nrf7rjzTEQoYimt7KT89Vp+RrfFj4ra98W/ik194hZtWETta2NvFCWXlhvMaDPzMAdv4e1YfiD/hJvDNt/xNNK1SxhdV3JeafLBGO4+8o54r9SP+CO/wAGPhV4e8OXXxy+IFxounajqF5JYaANYmiit4EHBkiVz9/oMjn86+7/AB8ngXxH4Zm1LXJfC9x4duI98lxfywfY5VboS7HYQfrXXicw+qpRpwuloeTRy5YluVSTu9f6/pH4SfsyfGDWNF8INpPgXQ1u/FEMklzIz7ZTcK2MYjY9sAbVBPOemTXq/wAabH4mfGzQvB9xH4b043kkTS6ja5WOS2uY5vLP7zqi7drHH97B6VQ/4KKfs4eH/wBjr4/eG/FPwxvIZPCvix5L/TZrOdZreznjcJLDEynGFDZAzkDjpXnfjjUvEfhG8k1htUvIIYVaYFNT85Dux/qYy+Qz8ZyB36159SUKzjXo2XNrrvfZrfp06ntYODhCVOq9YWWnbo1c85+J/hKb4feL/Fmi7kt4476SSKONifldVOF/vAH5c9ypp2leE7PSPBun6pc/YLWDUL2ZrZ5rtWa4jCwRyQtAp82LaxYrIwCNh1Bypr9S/B37Lcnwl/ZCXWPGWl6bfXml+HpdX1b7fZwz4laEyvHvdCcAkJkHqCRX5Gi7Hi3UYo4bWKO41CdIYIU+VYy7HC/7ozx+NfSRjJUoxl2V2fIx9mq8509U5O2h1vxT8AeDU1vPhbUJ2tdi5j+1LcO7/wATAYUKmegJJNU/hLL/AGVda9oN1n/icWqy2jnIAmt28wgj1aIyjPqAO9fZ3w8/4IU3vi3w7Y3jeMJrPUpoQ7wQ2+6NSRnAYnPFJ40/4Ju/Ej9hOysfihDb6V4u0/wpdRrf20mnLcTXUFwy2xURMpDk+cAMfMCQRkjFedTzbDxmqSk3fTW/5noYrJa1WlKcopddNvu0PlC4vY2MMcMazPjBjUZLEYHbn8q66HQ7KCxkuvOuIbW6iEkFhLDJCVkxtO4sNrhcsAQTnqcdK/V/UvgJceHtOuLrbDodrawtcztFZQWrW6Ku9921BtKjOfTBr45+M/wp8M/FXx1da7ql/r92/kR2yRSXYVYgmcDIGec5x0FetUlV5b00n6ni5Xg8B7VfX6klGz+FJtvtrovU+UbTQdW8da4tjo2m3t5qVxK5gtbWE3Ek/JJ2qoLH5eenSvvj/glh+zFdfGD4O63DrUB0WTRdUk0oSXCPHO7sRM0ao2CBGeWBA+Zl964f4S+A9D+Gsksmg2MenXUyNG94yCa4KE8oXY5UZAGBjOO9bej/ABo8WfDf4gLqOk3rXXlyjzoTMY2eNVQgYyRu3FucdCBWFbDVKlG8pLm7Jaff3PQ+tZXQruGDpT5baSnJNp9fdikrPbq1v5H6iaT4bs/Blxb2enxj7Pp8AtgoHUBAMn3OKyvHt+tv4P1WZZltZIIHkeSRd6wqBkuVBBKgZ4yK+Kvjl+3vrvizw7qkfg/XG0vXr+JI4bEMI7iEiNFdyMMx+YMfkVhzXzxN8afGWqaVBo+u+PtajkvFeKa8bUpN0x5LROJMbcjjBGCARXxtTBV5OXMmkm/zPrcNicOqalGqnO6XLrdqzd9raNWte93sdz+0rc+Pfinp+j3XhHxQBcXuqI7G3nKxxWm05Furd2xGW6np1rwzxh4MvPjl+0LqXg3Rft3iDxlFZxWEq2cZk+1TwJmRyyjGBvxlsADknJGe/wDB3hqfwZ4dfxNq+r6UIdJvpdUEkCqvmDyWjVFIOM7iPlA5z6133/BIbw1rWg/Dn4r/ABK02yj1TxZqWvy2SxyOrYtUVZCB0+ZpmbqecJx3rqy+KlVnKO0dvn/w34izNJqNPdvf5dv+GOc8F/8ABGPxlB8NL3/hINRstP1y62Sw2ULGUQlc/I8i+vAOMge9ePfFD4ceKvgNrsnhrUprqzvLWLzoWgkbbKnoG7/Xj3FfqF4q+M/iy3+AljrEvh1o/F12Sv8AZwAVMjplmIC5468DPOK+V/2uP2frv4m/GvwH4n8R6m2i6RFELfWoogjSTmadbeCOJC+3c5kwGzgnYOrAVMcRVhiVzS0/ztZWX9XOPGZXTr4SUIx1s/w63fofF/8AwkGqfavM/tK+WRT/AKz7TJwPrmtiPxdr2taJc2lxfXd1Z29u7qLiTdswD90sc5z2HPtX2Vdf8ExfAAk+XxH8QYunynTLNsevWcH1qpff8E8vh3pNrJHJ4q8dFbhDGqtplorE8DjE+SBnn0Br6j2bR+XfVZvXT7zzL9r25Wz/AGztSt5G8tdJ8P6Lp4z0Vk0CzjCn/gTAfjXztdxXdt4ktdLtbiOaS7gE7mILJ9mHl7yDjJ3jJBBGQeCBXpv7R+o/8NX/ALe39mWd1/Ytp4y8V/Y2YTfPFBZxxW4AKnlmWEEAcZYelfqZ4D/YV+Hfw30Cxh0rwvpqzz2y+dczwrJPMe5ZmGST1zXvcQZ9iaFOng6DcVCEE7Ozvyrqu1/vv5Ht5Fk1Kq3Xq68zdr69e3yPxf8ADPiDUtE8Rw3jRmNI3EkYkHzH3HJDfh04yKk1+NrSWPy90lrMN8cmeGX6+o7iv0k/aq/ZH8J6bo+ra14bsdDvY7JP+JzZRJHK6oMYmj2/6tk/iwRxgn7tfnp8UbDRfD3iptD0zWLHUJrhDMbOKcTPayLhhkgn5ZEJA/2kH96uHgvjCrSzJYes24VHZ3u7O+jv+fR+tju4i4chPCe0gvegrrzXVfqvu6i/B/V/7P8AivoeoMzbdGll1cnOcCzgkuyfw8j9K8g8CSfZPDmoKzbdumRwcn+I3Fsf/QUf9a9H8CLNDfeIJWhkVYfCniI8g8M+h30S8/70i/pXmumJNHoOoYhkyZoEHyHnibP8l/Kv3GVaLrWXaP5s/N6NO1L5v9DWhuc2MhBO7aTjOe1dj4/utnxO15SG/c6hcRYx2SVkH/oNct4D0mTVPE2k2bxybLy+t7d8xn7ryop7ehNaFxLca5qdzfNBM0l3K1w37sg5kYucce5r0ozg5ryX52/yOOpTZ1GnXDRfDm65I+06pboexIWGZj+u3j6VXgm8uKT5vm2kjJ6nmpDDNH8P9PXyZF8zUJpCAh6LHGAen+0aXSLFp9WtlMMm2aSOM/JzgkZ/nWlOpH3n5/l/wxz1IvY6vx/L5PjG8gBytmUtFH8OI0WMf+gfpV74cssHi6xl7WrtN07Kpb8s1j+J7xrvxdqU7ZHnXMjHPbLH+dX/AAdN5V5dSdo7C5dDnuInA/nXI6n7m3l+hm4e9fzPe/8Agk7oMet/8FBfhLag71t9Ue9fIzgW1pPcZz/2y71ueJ9cbX/EmpX5OTfXk91nPP7yRn/r+lR/8EfnSy/bEXWPM3L4X8JeIdWLE/dKadNED7f62qsN7CllBlosrEo4IPYf/r/Cvn8RU5s0qNdIQXzvN/lY7qcX9Uj5yb/BI+i/+CYGmG/+PuqXJUYstBnO73eWFB/Nq/SvwSuzw+G/vSt/Svz4/wCCUuned4l8dX25W8mytLZSDnBeWRj/AOgLX6G+FofL8M2vbcGb8zX5/wAWVL4iS9F+Fz6bJI2pK/mXJG3Ck+9x/OlkXI+nrTox8/8As4r5CJ7UrkyDFsvX5j+f+c15j4sm8w3TD/lpcY/Abv8A61enXEnk2ufRS3vXlGut5kMffMjsf0rpqStSZzct5K5z1xw9FLc8P/iBRXkc6OuPNbQ/QsNmoVvY5Lkxq8bMvVQw3D8K+TPi/wDFP4a3/jNfAOgp4u+LXj68LINNt/E18ttDn7z3MqSrDFGvUkKcdAM4Fep/Gn9miw+MfwAPhu40zw/D4ltbCKaxntoWW3t7qHaURXyJPJLKIz8wJRj0NfpNbIoYdUZYuUqaqP7UEmo/zqPPzOPm1FO2jdnbwaGa1q3tPZxi3HtNu7/lb5LJ7aJy31to37NmvkPxVZ/YfH2sQELuhvZVx/wI1YsvGHiL9nT4f/CfVNO0VtNXx1rdtceI9HttPEg022lsh5kRkxuyk5Db2wcEr90CuV+M2s61H8ZvEEmn6hprWEl20kQe1YthsN13YPX0rnr5XKhUtGXNF3s9vhdns2tH2bT3TZ14XHe3heStJbpO++qd7LdW3Stsd54f/wBavr6112npuC15N8OpvFfinWobGybT7m4kz8ogKgL3YktwB610snxQm8AfEi20vX2lj0lXjSfWLXT5JbKN32hV39CAT8zj5V55OK5ZUuXRtHTGEpPRHwf/AMHAX7Uem+FdS8H/AAzmutrSaZqXiK8jXkNIsBjt1PvtEuB/tk1+bvwY+Gknjb9rjwz4dDFotL0uO6WJSV8x4YIFUN/wJn6e9b3/AAX++LFj4l/4KU+IZLbxJpmuWuk3NppTXVjKskaRhJPMjyuQNqsAcHqDXj/7Kn7UFr4Y/aR8L6l4gvVtGunFv9pfjbN8qYLdvmT6cmuetdYNyV7u/wDX3Hs5bCH1uEW1Zf1+Z+hvwt8P+NtD+IlxZ6gtjLocSGSRIDIvkqq9g7MSc9xgYr5//wCCil9qnxP/AGb/AIhR6toMOnafo5+0abLHKsvmJGyne44ZGOWAxn9a+rrjW9ajmfVtFuo5orpViWTzNpaJgCyEbSrLnnrzXyz/AMFVPjna/D39lXU9B1MWkPiTxpGILe0EimRIg+ZZMLgBegz0yeK+Bd5VYOKvK69d1r9yP1+nShHCVpykuRJpfc738m/0PFP+CPP7Quh3Og6p8M9Uh0v/AISC1nfUvDMl0QpuySXaBC2VEityvGcN/s1+jmi6h4g8cW+l3ljG1rczMrXzXyhRaoOCEVT+8cnjsB156V+Beh+EvOn09o2KSCRZBKjbXicHnBHKkMMgj1FfeHwY/wCCh3xG+G/w7bRtY8S/bLFICsN8beOTUYeMANKwJbj+IgsPU16mYqDem+/zMeD8Jj62FdTlXJTVm9tN/nb8jS/4OEPjLpl5feCfh/Z3Edxq0LSa5qXln/j3Qo0MKHHGWzK2DzgA9xXx7+xz8er/APZg/aH8I+MtOkkDwsv2lVbaZIidki/UqT+IFYH7QV9rnjz4hXPiLWJbq4/tA/u5ZyWZgMkDJ5J5Jya5K5maDTLGURllSZ4ww6YIU4/WunDU4rDqmuu/9fcfJ55UrRzSpVrRceW1k10Vtfmm/vP2O/4KK/8ABTzT7z9my+uvD/jKxuddu7B7ezhk8uS8gk24QqpBYNvZe3Y9q/FK8e51PULie8kuLi6md5LqadmaV3Jy7OT8xbOSc85r6t8Na74l+LPwAtdHtftGvaj4bjuYrO3kuCE09pxte52sDGAY18tgSgYMCTlRnyPW/gx/ZN5rjXFnLbix0ZNQK+ZsWCYmKMqy8kh3lXjIwxx7DkyuMaPtOb4n18l28v1L4hw9Sv7GNPSKW3ZvXW3W3S2h654M/ZU0f4teKvE/jXVPEmnv8N9D1OK3llth9nOrSJHGNsfA8uMuMbgOmcCvov4vft/+OJkhs10exbUdJQRWF40rwzY24xN94NuH8a4r5s/Z78eWcfwp1Xwalqskx867uLZCF+0252B1QHlZYmVZAcHIDZ4zXXfDKWy+J3gXUfDz6ql1r3hXbHbO3DG2cDyUY/7JBTB6HZVYj940qS96Kur/AHNfPT+rM/duD+F8gxmR0cNVgpSrJqUr+97SOrite2qS0W7Wp+lX/BNbxz4R/a6/Za8TeIvF0kdje6AzWep6NeSoDZzxRocqzEKYmJG1ieQT618o/FP9gDQf2pvGXibXPB+t6fqmqaxMG8mxvYbmONy4RpC0bFQMLz7qfeuE/ZG+O0XwM+LejyyW63Gka839kazZXCCZGYnajlCCNwfI6cAj0Ffo/wDs32nwz8EP4gt9BsbeBrqE6daXFsn+j2TB2d4Aq/LEqs7ZwMbnbjJJrzcTipVVaL5ZavT0v/kfk3EHC8six88NL34aODa3i+/mtU/NaHzj+1X8HfCC/Bn4feHvBc9rqN78OLuHQr1rKeKaWF7jYpWREYuuZBnkDmvL/wBvX9o7xhqdzbw2N0qw2sBjNxuPyoMAD8K+0PGPwd8E/DX4eeKpIbbSdFu2/wCJlHPNttyJbmSINKsjEDLSRQbieWaOLdkBRX5b/wDBSSS+8DeCNP0nT9RXVo7iIfbNSS/tyBzgoVVs5PHIHRvavJwMZVJ+zgtJNXv+Jx1KkKdP203rFOy/r+kfG/xH+J2sfFHxY02pahPeQwOyW6McRxqD1C9MnGc9a9a/Yx+G6/F/w98UvCZCrda3otuulTMfkTUYrjzoEY4+VXSOcF+gAIPWvB7cL5qtjgHhfWvWv2O/ixYfCX41afe6tqEFvoV8xsdW4LFbaX927/KCVKBi4I5wGXoxB+4xFOcaDjh1qtvk7nwuDqUqmKU8W9G3d37o/T39nP8AZO8ZeLv2YfCZs/GWo+Fb6PS44JItFgiSSxVNwePfJkHLBmZiDksSOAK9Z0/4KS+KPgveafYeOptP1GGd2hMd7BJNZROkbApG4I8wZ80lgRtkGQBzWV+zJ8VNN+Jnwr1y38O6tZXFldW0lpZzQzeZD5Z27QdoHVNysAARkjg1e/Z7+OXxk8V+LrDw3L8GdPtvtN4sOtanPr4l0m3sjkTSKi26u5Zc7V3Zy2Ca+RxFSrKMm9Gu+n9bbf0/t8HhYP8AhrmVr3utjzn/AIKSfsG+JPG/gHwP4k0mG1v38LtfanrsV7MtrDfRR2xRJCvzILhspGAoAfCk4xkfkNd+JNBtNWXV7dppIlbdBYS53Rt1Cnr8o9RX7Hf8FjP+Ch+j/szeC0+EMkmpXXjy78EB7e6gVGhtbm4kSJRc5I6xJLICM4YISMEV+Mmr/C6/8KpZLqyzafJfRC5to5raRftEBHyyozAB1J7rkV6nD9OrOEp1tIv4fNat/LXR+p4Ge4ilBxjh3d6uXk9FH56beh9//sxft9fET9sr4Z/GTRfiFrGnWvgvUdDGj2UNpAUmtL26+WCJOSzx7IpGcvnnByOleD/slfsZavD+25oHhPxK1q0NjanXmls5C8VxHHjYPmAK5dgCpAP4EGvFPBnxj174UaBqGk+H9QWxtdQuoruaWO2iaZpIlZUIdlJCjccr0+mTn9Cf2Cfjv4T+PmsWuuWtjLB420mCKHVp5IFjWKWdSrLG68yJL9n3YfO0qMYzXZmjxVKTlGzptW81/wAP/XQ5cnjgqsFGd1UTuuz8v6/zPtjwV8btP8E+LP7Hv2uLWS0RC5WwkkVgzbV2vwCcn7q5IHJ4Ga9I+P8A8cvC1h4Q1iw/tBbePRbW11fUrq7RobazRJUuQ3mkbMqsJYnkLgZIJAPN65qOn6L4Is4roRp4g1i6+zWTMPl+Ta0mGII3FSAAevOM4rlf26te8O/DP9gr4y3HiS3Y3Wm+C7mxZQrNKLi/K2VtETgEbpbhCM8hVdsYFfH3Uq8HbeSXrr/X+Z9fiKcVRl73R/l/Wp5L+0t+35ovj/wLrnhnw74w0jxBeb0j1SHTrpblYoydyqZFJRgzhRhWPQg18k2vi/8Atj4h6lou/wDd2sNq0r/3UG95WPvhce2a8T/Zh0b/AIVz8IbG8nXbdeKLkXEgK/8ALCM7U49DgmtLwr4iaX4z+LLhnjb91BbKW+6zOqDI+nzHjrmv1CUFGCj6v8D8kcuaba/rU+orLVl2qwK/Mu4Afw+3rVDTmXVZ7y6Q+YvnMoHHG35T09dua47w74qV9Xk8x8KjYUEdfQ+/tXW/DAG88OyeYqqLh2dA3/XR/wA89f8A69c+I933fMqj3LvjbwfaePPBd5pV3bwXS3cDKFlQNhscHn0OK8tvvAkfjbwxZtcarqi2V5HBIlq8gmt7c5CsqKwO3k54IxjjFe3LG1vIpVtu0F2wc5IOK4250GM+CLu3jVUZTexo78CMLK+GOegGf0rhlrGzOmNSz03OR+MU/h3wL+z/AD+HZL6aHWr6WJ7SIRMfO8qVWxn7oU4GTnPSvSP+CLX7WFj4Q8S+Mfhzd3CaXqd8ja1p0xB23jMqpIDnjcpEZwOqkkD5TXh/7Z9/b6T8JfDN5E0c7NrdvFFKRyIjFM0jD2YopPr8vpXF/scaZdQ/tweCr1YSlpNbXaE4+WdFgZXB+m5T9cV5tTB4ejS5abd5KTd31vstNrW3v1Po8Lj8TWl7WaWjSVl07v59rH7M3esa++iafHHZWcc1tOrPdm8/dRK3323ffbjPBUAk4PFfBH7Xn7VEf7TH/BQjwF4L0eRY/DvhLxdZNfXkQMbX9xAyvgc/6tHzt9yT2FfYFz4mvIvBq2rNcXEFum5IWckMRyB7gf0r8l/Fknib9mD9q3T9b8XaXdW9r/wlC6s10q7vtVsboSOwH3twQnr3AFeVhYe0xTfXov8AL0/4J72OxDjh+y6/8H1Z+pX7bvx/8WfCL4MSax4f1q40/VJLqNDNhZMhm54bI6A18Zn/AIKQfGkNtfxtJImclWsoNrfUBK9q/bh+M3hb4sfsy2134X8Q6br1n/aFsjyWk27Z/rCNyn5lyBnBAr4lmiVAcFtxHPv9P881+ycJ5fhquDc69NSfM90n0Xc/H82rThWUYStp6HsHw1+Lt3+0T/wUn+D0XjrVH1DVLW0jFvciJUSOSRpJhGUXA5QgE+vHSv1O+Dfwu8SfCLXPEEdnra3n9pxi7gha0htoLAD5WcIoCkuwJwc449RX4Y2fxCf4M/tJ2/jpleeTw3q1s4jDffVNnmop9RHhR2Bav2w+Cfxcs/2ntGsfHfgfXrHVvDWsW6wBTEfM0+VQPMik2/NuGVzG23HByQQa/M83mpzm6atFuXTRb6LsrM/SMphGCjTk9dN+y6vzZ6r8C/AuteHtG1VdX1bUtW029DvPFd7JLeBvmyYhsBjzk5AJzX4lftUzWPhH9qm30TS/LN5p+pSalcTqytNF52xI03qNwxHGDtzxhT1JNfqJ+3N/wUN0H9hj4O3XhH+2D4j+JviS3dNN02ONIXti68TzJGNsMSKwYbvnYAfeOTX44/BPwzZat8UdPtVkXl5Ly9uCPlyucsSev3ix/wBpsDrXzmFpyvKvPTR2/K/9bv0PYqSjfkilro/z/ryOwvvHWveH38fR/wBua5/oegX8QDahNhfMkigB+9j/AJa4+teW2njzXH8Ps/8AbetMTcKoJv5Sw+U/7XvXXfEPxAuoWHxGvEV41m08RIGPOJNW04qP++N+RXldpekaJGuTgzsf/HFFf0rga0ZQjKpvZX+4/GK1FQclHa7PTPhv4+1oeJNPZtZ1jbFIZgDfSlTsRnAxu9Vp1j471qO3VV1vW8KoHF/Nxx/vf5xXK+Ar9l1Js5/d21wQT6+S9amnoQ20cjrjpxX1OHjTlqkun6njV4tdT0a8+ImvW/hXQ9uua3G0hupWxqMw3KZFQZO7pmNx+dXfCHxI8QN4gsY217XCDOmc38u0fMDjG70xXJeJptlnoMJ4aHSlZx6eZdXMw/8AHJY/0q74Dby/E1ozHhN7tg9AFY/0qZQpKi9F1/M5mpOWj7HR3PxO8QSXUjLr+vbfMbbnUJgByenzf5/l0Xg74ka+mmeIZpNc1wmLTQI919K2Ge7tos8t/deT3GDXmVpcPOnzN8zYJIP3a6nQ5W/4RLVl3H99PaxZwOR++cj80U/gK5cTTilay3X5oI97/wBWPsD/AIJe+PNeim+NGvTaxqkn/CP/AA8uxbubtz5E9zcwW6MpJ4bL4BHPNblz8YfFkTf8jR4ibb66hKT/AOhVy/8AwTstv7L/AGRv2idW+817/wAIzoUbnuG1L7Q4/FYulF626BgAvTuP8/WvnaNOnPGYiTitJpbf3IP82ztnKUKFOKb2f5v/ACPtP/gm54j1bxB8PPE95qmp6lqW/U4YYjc3DS7AItxxuPGd3avtzw8mzw7Ygj/lgp6evP8AWviv/gnJYfYf2b1uP+ghrV2+cdRGsaivt2zt/s+nW8fTy4UT8lAr894kkvrM1Ha/5aH02Vp+yV+wSfc/ChRz+NKRmnqnz+nNfPwPRkQa/P8AZ9HuD02xY/T/AOvXl2snKQr/AHUz19Sa9D8cz+Tol1/tYXjv0Fedaw377/dQDn6CtsS7UrHNH+IYt03z/wCNFJevtk6/1oryeW/Q6rM9H8dfE/4M/sheNdM+Fvhm+8P/AAruNcsotQ1fWGjb7b9keVUSBJn3SNdTE4DyMTGu5xlgMfXMtzZ6HaxIzQ28SbYowx2gdAqj+QFfzi/txfH+4/aN/aU8UeJr1iV1rUJDDExyIoAdkUf/AAGNUXj096+/f2v/ANsvxV8Pf2LP2UfFWlX5PiTVIbK6u2uWZlvzBbxr+9Yc4aUhmwQSfav6c4h8Oq9T6lTdZyrVW1Ucnze+4OV+bd/C46tpJJpK7v8Al+W8VQprETp01ywScUtFy8yWy0W6elrvd7W+5v2jtU0HXNWi0i+8WL4eutPt/PaFonPnCYMsZyvUZjb178V883WmhbpM3Md66oA8ysWDkEjknk8Yr1r9ryyjkuvDV6206hNZtHO6rhXA2sPyZ3IH+0a8nsI8D8a/OcPF/VYRvoummju762Ts3rrc+4hGPtZVOr3/AE69Fodd4A8f2vw10fxBd30TLY/2f591cIdrQQRTRtKB/vRNIx/65Y6mvTvD/wAT/BP7YnwffxH4D1yx17Q5J5dOF5b8wxPGdroVI/p0Ir80f+Cwv7bWrfs3/C2Tw14NuJtP1XVrRJL+8WQfaIoJn8pYFI6bgWLnGdhUYGSa8X/4J7f8FGdY/YO8b6xoslrJqvgfUrWGLV9DjkCTRTxqV+1WrZ2xykYyDlZAq5wQGHPHKamMjUqU18OiXd9fw/HyOqrjqeGcI1HrLX0XmfSn/BSH/gkt8DvjF4UupvEPh3TtJ8VyRNJbahYZs7yZ87SwmT5WI64mV14GR3r8Kf8AgoB+xl4l/Yz8QWdjqVxHq3h3VrqWXRdSZRFcNswWhmiHAdQyncuVbOR1wP338T/t0/D/AOMljcP4Z1i11q+hUNY3WoxjNxHLgyWWp2W5WRkyQJ4MZxwVON/yJ+2Z+z34V/ap+Eup6B4hsLzRLe1MlzbXpuPtbeD5VTcuoW8u3/SNMK581eHWPsjD5Pi62IrYWu4Tul1i+nyf9fgfomByenjsHenZzteMrrXbS66euz7PQ/O/wl/wVD8Ufs8fB3S9J8F6i02rSKGkTUYVvLOzXHO1H+bcew3be+O1fPPjnx34g+NWs3/ifxVqd1rWua25+0Xs5A5P3UVVwqIOgRAFA6CuS1zSG0rV7yx+0Wl41jPJb/aLWTzILjYxXfG38SNjKnuCDXV/D60/tzw8bMn94r71Hp2z/OqqYenQjzR3vq+v/DCy/FV8zxTw9TROLtFbXXXzb11+4seBI5k1ORNu7ZNknHRThW/9lNe0N4Ns9P0K3kbdcWlwNrFXKtnOQQRz16+1eS6/pl54H8W3SJuEUiK+V7gY/r/SvZPBfiS31zwhb6Xe27Wl9ZDzSrcrMgBO4H8Rx/keZWkpzjM/YOBcLToU8VlmIT59Urp2ve2j21XfdLQ5f9pnw5Hon2WzjZUiithdzO0m7dyVCgeuW/SvEJrn7Tpvk7n/ANHcOqgcNjAP6YOf9mvo/wDaV8Kt4htdHaaFII72WO0uJlXb5BVTyOud/B5J5z+Hn/x3+Gmm+EtRuL7SYpk0zULwxabBK37yGyjjAWRv9pzlj7OvvSwuIjB+zlu27f1/Wx874hZZia2YTxEUorlV15W8tO219W+zOu/YB8STL+0hpa/Z4ZlvIpopleziuMKsTSBl3jKE7CpZGRsHG8Amvvf4Zfs8aRq/7W2k6ZdaSutafrlubdoZR5gulaSO5j+6SWbK8EHII6kjNfFX/BNLwXZv8T7vXtUW3jt9PsNsMl1BFJCJnYrjEl/YfNsDYKXAbkjawJx+0X7D37KniD4xfEPSdc0nXIPDXiLQ7ux1fT7u+tLjUbLVY40nSa1bzbyeXyGVgwK3cxV4gFkHBSq0UtYK+tvw/wAz5unTlGhGtXlZ2cm32b8tdtTg/iL/AMG3vhqf9o3UPFkX9oeAdD03SLjUYLHw3etLrOsX08ssszPcXPm+WqRYUiMFn3suQpbP5qXfwJ0v9jj4ya1Z3kk2p6BqN4trBLdQJFcW2FfzLScxhQX8t1kVgATsPQ1+y/8AwWc+J3xe8M/BTxv4k8L6pq3hrxb8KvEMGpQahaWgaG30pvKkjuo9wKsAqSrIH3LgOCOePy1/bc+L+lftbfAbVfGdnptvY+KNWuLI+ILa2ASPTb+NyYrm3DMT5LqZFByWwVVt23I5cVipUpxUdFHo+z1v9+/+R9JwBHMsPXhmdCKmuZJpN25mrWav9qLtGTVr2W9j558Sakmj/EW8jtbh2VbszQys2WbDbo5M988c9yK+3v2AvG2i/Fm8vtQ8TWdjpupzM0tyZ08gMACS4cYJXg4yeAMdK/OODVbq5KQ6hi3vrc/upwD5b+x7rn8vevWfGn7Z/iofstr8JtA0e3sdQ16I2mq6/Iebaw3k7VbopZfkznlV45Oa8mzlVfK0ua+t9kfofiFRqZhhqeLw1OUpxlZJL3rS6NeUl6Wk5Xte3d/8Frf269A8eGH4N/DiXT28LwyLf+ItVtV81NXnRyYraOQ8tHE4Z3fJ3vsA4j5/Op9MtUfi6j+oiORXpPxh8CrI63WmtJJHo1nHDgj/AF8YyxkHvuZjjuPSuJ8KRjVfENnB5ayrJIMqejKOSK+qyd0o4VKn03738z+eeNsmxOAzSVCvdp/C73utnZ/4r/n1u/cv+Cef7Edr+1f8TLi41q+uLfwP4dCyalJAmybUZCy7bKFs/IzruZpMHYg6Fior6+/by/Yn8Ax/s0a/f+GfBeh+H7rwzp8t9Zyada+VLGIkLkM/3pAVUg+YWJznrzXP/sI/EKw0fwhpdmsUOn7YGvWEMfl7ppL2RHV/XbHCFH1PtXvP7R3xut08IeJvB8MlrcXVr4A1LxDrQEYaYPcRta2FsV7KzyF27nMPIG4HwcxxmIqV043Si9EvX9T0svymhSw3vWblHVv0vb7j88/+Cfv7fkf7K9rNoWsWU02jzXX2uC8tuZrNmC7ldP442wGz95SO4JA/VH4I/wDBUv4c6x4M/tDR5ZNR1Er8trG7xxeZ2LZ+VQOvOcV+IvxH+D998PpEh1L/AEWOJCLPUBE32e7UchGIB2yduePfFY/g/wCIetfD24LWN5JbCT78TfPDMPdTwfqMH3r1swyuGMg50XZv7n/X/DnzGBzSeGfsqt3H8Udh+2/8fNQ/ad/ap8d+NNSm+0T6tqJiRh90QwqIY8DsNkan8a+n/wBnmbR/iZ/wTn8cW3ixZNSsdG0m51PRTK4dtMuLcW6zNbbhmNnnuYSxX5T82RknPwtOiy3MkxYKrklxng55r6Q+B3wU+Lnj34X2/hrRbq10nwh4i0wxTG7ZVWaKW5juXxhWkUs8MIOMblhAPBOdcZRpww9Ok5KKi46+nbzMsJin7edVq/Mpaeu1/I8XXT4JbCP5o5plRftDqSFRyu7A/UfUGvsz/gnT8B/EPwW8eyTaxHNaxeLtMtLloGXaIN2ZoAT1EgR1PtvI9a2v2Y/+CW9ofiP4YS/1T/hIo7PUkvtXtntzb2/kRq22P+JmDycdvl3fQfpt4s/Yxk+JPiC11fR2huL+WONbmz2NbqzoAqNCxXAG0KNrEfdyCeg5sfipVqNsP/S8rm+W06dOspV9NHbyfn+Ja+Hmh6t4j0ext9Ys4LzS0wWeVQyj3K96/Nv/AILr/twN47uLP4R+DtFm0X4e+HdRS91a+S0Fqmv6kqMsKhR92GJTKVJx5jlm58tcfqpZ/CT4lXujDTbfw7fW6qNpkTymXHI+9uwAfWuL+Jf/AATf8J2X7PvxGPxESx1BvEGmK08KgPHpMNqZZ/PMnH74b3IZSdg4BO58/O5bh60cZGdSF0r76Wffs2fQ5liaTwcoKoru1kne/e/lY/nj8J/FG/0W1msmkZrGZCiKST9nJ/iU9cc8jp+NdhD4yktvHmqfZZtwknjIYNuyqIoBBr23/gnT+wh4F+Kvhj/hZPxV1iZfAcOq2mj2mkWdyYpru4uZPLiN3MozFbiQrGShVmLZLRjr1v8AwVI/4J5aT+yN8RvCvijwXbnT/BnjJntpNNM7yjTLyJQzKjNlvLdGDAMSQQ3OCMfWTzOj9aWF1vrrbS+jt62/4c+TWV1vq31rS3422ucn8HPEN1dapCZm8zC7zkZLDrX0F4D0m30fQyse5o1dm+c/MNzFj+W7jHtXzJ8D7nzLuS52jy1k8vHbHt/n86+lfCWrLc+HYZFONy8ANjbnGfx61pUqOUrs8+zRqeKdaXRvAF9qG5IxDaStwOhHSsLx1obar4JFlayMsmtyQi6nkYfu4pnEtwR2xs3AAeorF+PGvfYP2b/EX74rJCy24B/i8yVQP8itXxZdLqXifw/pcjMtpa2pv7mNesxwsUEZ9siYn1wtK11ZdyFueI/t46VJ4svfCGmQwyeTDb3d3bxq33j+6jTP+yqqxOP7w9a8f8LeO/E3wX8UW+qeH9Qm0fU9Qsd8jmGKcjL7W2iRHChmiUnaB0r3v9pjx1N4V/aA8MINBtvE0q6G/l2Uk5hQym43ugKq38CxHBGMDP18R+LOu3vjDxDd6vfaXb2V6sywXEWnRSLZWS7WYQHzMlXVg6jn5zG59C0YOnUqYhKok6avvZ69rev5aHsTlGnhP3banptf8/T8Db8Rfti/FzxnZi31D4ieKmjbCiOC5+yqe2NsITNclongTVfiF43t9Na+abWr26W1KXchluGkIz82cucAEnPTFT+HvDl9qmnpbw2stnPr7TafY6ht8wGUp+6WEgjaWl2xPISSqzLtHXd75e/DP/hWvh+3k2aO2tWz22rX19PAHTVEjjCMm0tmNPIMshZg27aSVzgH2pThS92lFL5f5HBGhOrHnrSb9X/mfNs+r6h8OntrqNvLuJjk2sieWxUbTtlQYZdwPQ4PXGMZr2CH4iaXdaFDq0eg6JDazxCb5J7/ACpPVfmumGQcjkHpXz54o1/UPFOsajqGq3M97quo3kt3e3E0hkklkYklmY9SST/9atfwd8SrHSfB50nVrKa9sWmdyY2IePdjGMEcZBODnqa9COZVcNRnyXba0S79/uv9xw0sHCtWjzNJX1b7G/8AEzxBZeK/D01xEoXzpJJsAYG55CyjPoEI69kHU19J/wDBDvx1rXhDxv49sdL1C5tbfU7a1P7i48tZZY2kAwueWCu3OMgH6Vyv7Ev7MF5+0j8SNEvLGwvx4RvJFsZ54bYTxLIV3CNiVIX5eC3Y+lftPe/8Ewfg/wCJfhTo2h6j4LsGn0m0S2t9Rs5HsNRiA6f6RAUc/Rsj2NfNZbhadaE6Nfmins0k3e99m1dfNHvZhivZVIVKdpO3p+Ov5H42ftuw6Rd/HTXtRUTJcSxpGL2R2aS83FvNl+bJbLkLkdiCTyK8J+Gnwy1bxSmoeXFcWelacGkuppH2rOQAAjH+FQzDd/10681+pvxu/wCCPnjXxf8AESLTPA+nlfAzOILjUvEV1De65AuclI5Vi3rEMBduRn7zHnaPPP20/wBhXTP2UrTwL4NaS1vDqcM2rXVsHYmZ1mxGJuhMZbfKRt+YogGCoBeU8M4/G4v6nh7JSfxPpFK7ajve2y79VuXmHEOCw1D6xVu3FfCurelm/wA/I+Hvinb33hX4c6lM2mWrafqlxpdtZ3E9ku67iC3crtv+8fngjOCcjIPSvNJPEFuNNs1Oj6Zlt7ErJdofvY/5747dMYr76+Jfwzs/iR+zD8RrG5VW/szw7d6zayFBugmsYGukZewJELRnGPlkYdDX523jYt7Pb08neDn1Y1+tVMtWXuOGjJtJJX2eiS1aPgsLjvrylXas23+J2nhHxHpsX21n0tlaGzdgY71hnMkafxK3Zz3re03xVovk7m0/VI1/6Z30bYx/vRf1rzrTLk22n3jLwSqRn3BbJ/8AQRT49WZLf7w+4ckV6GCxShdSv97/AMzGthubY9i8RazoNzq8Kyf25E8Gn2URKwwSj5bWID/lon48eta/hBdDuGvZY9Uuo3jsZmBnsiNuVxn5XbnmvLNT1TPiS8VmGUkEJ9tiqn/stdP4MvP+JbrEn8K2IX/vqRF/ma6I1ealpJ9P61TOOVG0tjrLDSLGZvl1+zY/w74ZU/Tb/wDWrq7Lw4H8IyKmraLJ9ovlwWufLJ8uIggZH/TZa8z0197lh8uOP8n3/wA966qG6eLw1p0X3t0s9z067vLj/wDaP61Uoyk173Xy9exzSikm7H3l+xz8ONQsv+Cdni2O3jtJrrxB8QLLJW9i2tHbWMx+8WA4ZxxnPtVW6+DWuSxtmPTlDc5bVLYfn89Q/DPTl0f/AIJo/DK3ZURvEHi3XdVYf3hCtvAp/wDH2rkbi2VEO4Rg+mM/nXzuX+0lOrNSWtSfTtLl7/3TsxXLGMU1tFdfn28z9Jv2RfA1x4F/Z98H6XcRxx3U0cly4jmEysZp2wQykg5AXoa+r502uwHQHAr54/Zn0b+zvA/w9sduPJ0nTiRjpujWU/8AoVfREhyn1Nfmuc1HKu2+rb+9n1GBiowt5JELLnH1p8A3Tj60hOW+nNOi4f8AUZrz6e50yOb+Is3/ABKlUdZJR1rhdYYGeTG7qQDXY/EKb99Zx56sWI/KuK1WTG76mqxb91Iwp25mczr2pLYSpukCbs45xnGKK8R/bK+ITeFn8PpDcNC0zXRbb1IAgx/X9aK8epjKNOXJKdn2/pnrUcDVqQU4rQ/M+819tT8TwtuY/vz0PLDP51+4H7MH7GMX7UH7Jf7JviTUdSjitPhva/2rLYS2omTU8g+XGeRgBlU59unavwS8Fap/aXiKDP8ADNwdp5H+fXHWv6P/ANinw/feKf8Agkr4D0nS9VbQdR1PwYlvBqCD5rN3QjzBz1GSa/tjxUxlbDYWjWw8+SXtuXmteylTnFu1n0b217an4Jw1haUq9WlXV4qk5NJ2vaUXb8LGv+1/410u/wDEul6CurWNxrVlbm/l0+Jf3sFvISiysdx4LIVAwMlSa8qs51t1aSRlSKMFnY9FA5J/LNee/Dy7+DfwnuLX4X+AfEGoeOvGGnpc3niPxJc4nnaSNkU288+M5y42RL8qqp79e+ghju7Z45F3RyDaynoRX47jMtWCSoQ5rW0co8jabevLuk91fW1rn6JleMeJp+1lbVvZ81vK/XTfp20PyN/4K4/E/wD4XR8Z7iW102T+zdP8QW0d38+BCBbGSFAD8xGCmTyu5RzzgfMPi34yxp4unv1hkjVok+1cd8sMj14r7w/4LD6J4Z8PeNdSuLW8j0m+1C3gW5jijMjXlxGmFKqBgEKQpJwOma/I/wCKXiDVPPa3lkhBj3bglwryJuHzKSCByAOOcY7V6WXQjhcEm15/fY48V/tmLcei0Nb4h+L77xbrt1rC3EkXmRGOF4XKtEmMAAg5/An/ABrKtP2o/id4N8IW/hfT/iB4ssdBsftAt7OHUXWOJLiMxzIDnO10JBXOME8VxVn4nutEfZNGZIZOdp4JH0qK+mh1A+bC3yt1H936142Y+wxS0XvLdPc97Ayq4b3YNqPkZslsdi+X5a7V24xwR6V3PwIeOG+bzFGGBVs9uePpXFSYh+ZiuO+T/Wvpv9lT4L/Dv9pD4a6bpWi+MtB8D/F7S7m4jurTXZJU0/xXbSNvheOZQwiniH7vaFwwAJHVh8TnVFRp8676/wCff1/E/QOBsQqeaQqSaVu/y28+von1KeueHYta19pGi3eZAsSFlxk7l7dq6rxx4Ujj11UhjWNrezARU65IVcD/AL6HBr07xH+xP8Vfhdoe7xN4D1a3axAlF5Z7L+3dQc7vMgZvlx0JxXF+J/Eif2ra3HlKskMKFlAILEMfXB4wPyr4qHLd377n9lZfg8JicNKthpxlzOLbTTs+zsHizTIdW0hdJuI2+1QOLqPzF7qvVfcdRjuR7157q3hdl0hbrV1d7SMxRsCOI4iCjAf+O8dfmr1K98R23i/w5dTXphklh+aOIfLkDnbkc4PNaHivxHptx8NdDk8IQXF9dRajbG7tjazXzQwGVCXKp87KjL8yrgkHPbFXUw8Jz5lK3/DnPxBkdKdKeJqOyjCTTtfRJ6W679X1Oq/4Jw6Tc/Du28RX9xBqOg6bqksUFpcz2V9HYvEuf3jXVtqljJGDlRgxXK9flBHP7yf8Ep/gd/wi3wzt/Eklxpl0lxHJDA9jqi6nDKxkdjKk4tLVmBRgMSxmRTvBkkGGr4p/ZQ/ad8SL4YabUF13xBoWEQz+H47KHT4V6EeRdz2s+c8AKGPsTwf1B/Yw0TRdG/Zz0FtAt9QtdO1DzrxYr22mtrhWeVy2+OYLIhz2YD8sV9DHCwjFJrazXr3P5O4izCp7KUV9p2+XbyN347fD7wX4w+FPi6Hxxoun614XvtKlXXLW7iEkV5ZxoXeN1PDLgE4PFfx3eCvHcWvy6zatGtvCs8lzbww52RQuWkSNQedqjgA+lf1X/wDBZD4gTfDH/gl78bdWt76XTrr/AIRme0gnjba4knKwKoP+0ZMH2Jr+RnwnqiWvja6mVo1AmVFTcBlVOBx9P51y5tRU8JK/9f1c6fC/NquB4gpSjL3Z3jLtZpvX5pP5HeXOp2uohVa1upN+NjBArDgEdT3BFQanfWLQ2lvdQ3VzHMzCKItGoymc7sngcHn2phj1B4LPZDA0dnuTe9wkbOgDKvB/2dv45rHXRlglsbia80dZrS3kt7gzX24OpBCEBQTkbieeua+ap4Wg9fyd+/Z+S+8/dsdnWbRl7t0na7nBRSV6d170Gm0pVFq0vcvd3Scmoapcaxr1xbhbW3s22WUluhMjoXicgs2AMcKRgYOTzxXiNkZ/CfidA3+j3FrLt+ZcgMOMEeh/rX0BpPgHVtbk06ew0vWNVPiC8js7O4t7NrLTZ5oyxRGu5sRjbuxksOFHFeR2+m6X8QfFGoXniTxFZ+GLeNtu77FcXTTlTtKRiJGA2gDLOQDkY3c49vKqU4OS5bRsu61Xk9e+/lufkHiRmGGxNOlKdZTrxnN2i1JKMn1cW4pq0fdi93L3Vpf1T9nL48w+APHiXOoLKsEyx214kZ2kR+cjllByrEL5mFIBJfhq1vj18S9M+I3xf1LxNfaHrM0uuOum2cVrct595aQqoj3gMuDsjR2XOA3TpkcP8SPhkvww8fTeHdWubUlraC70zVreYXEM8M0SSRb2GAyMjD5sAqcggY4o6nDcaE+l2+p3M2niG5ElpqCONtmdpzKrHiRcDBTgkelayoQ9rzdT84ljavsPY9L3/ryPVvCvj3w1LpNpax3fihbXUtJutVhgmlivIZIrdWaSPZcBwZAI3IUYB29R3wb3wJ4K8TasYdO8K69fXE2nwak0en6XFGqwzruTd/pixhu3yxjHvWPeWt94q0zQb63/ALDsdQ0HS77zlhvbeK3DB1+8N4CrJFKwPOAXGSOldhpXw+1Hw14y8NtcaTot5qFtounaettd68toY7tHZVJ8reZASuOhXjrxWEoxh7ylZ66X8++nSxjCTb1X4GTb/s++A/CPiPxRo9zp+oeINe0HSm1O0ghmWytbx1jWVoZSxlc4Rw2IjHk8ZxXceLv2pbz4e/CTxIml3ezbpdrZ6BeWIdBp9xNeN5A5ZiCNNgaQL0BkB4OAM+0v9J1Hxnq3iC48QeHLWwvE/tAraRXFxqD2tzZi1ARGRA2AN5QHcdnTJAPjnxu0ubWNTEVqh0GG8ujfvp13K262RYIoIfMVFOJnCzOUAPlhwpIzis6MVVqRVa7sk9e9tdP6/I0nzKD5OvY/Xn/gnL8QJPGnwl8J6p4X1aynnubc2yW/iJZrb7fIvlh2W4jIy4bcM4cPzwK/QTwx451PQpbe1uo9StrqaeK1AaMNC5eNmMivziJShUs5XBZR/EM/z2/sRftf2P7Mvh2PT72zuL2Q3DXEd1DtuVsSRhWWFjnaXLFwi7yCSATgV+tn7HX7Qt34j8I3fjCHVrrxF4X8RSxQ2EmjzS3tjpTrGd0EkcyrNAwOB+8RSFcbugx6FejSUm4S/pvb5HJGVZJc8fn/AMN3PsbQvixpurWXnRzRtHDGDJtibMSGSRFLbchVLxyAE8Eo3Wvln/guD8eLf4V/8E0fiNqWn3VsbzxLbQeGtNkR9waS9njilwQcgi1+0sPQqK93+F2u6f45F9fXmm6XarDMIjfWUpSWVonV0VyuMEONwHI4Bzya/KD/AIOUvilpVkfhz4D0G8NxHNd3/iPVJPtJlad1CwWyuMAZjL3IBOTgj05KNCSqJSF7aLjeJ8YfsN/E7xFrfhrx18FdB0v+2b74kaNdW/h+2LuqR6giiYZKqdvyQu6OdqJMsbSPHHvkT3n/AIKZftkWfxe+HHw1+Guj6hJ4luvDdhY6p4m1Ybdp1FrGJPIXb8rEBpHcjgM23sRXif7IcZ/Z9/ZJ+M3xqZlt9c1GyHws8Gyso3R3mqxsdWuoz1V4dKWaHcOh1AHOQK8H8PSm0W3aHasbMAygYxjOP8+1GIy+lUq/WLax/F2Sv8l/Wh1UcxqwoPD9H+Cu3b5t/I90+Ed59j0ZhuMbO+4nI4GeMV7h4A8S/YvBxhZlZ7WQLksDweR+X59O9eB+DroQ6bHGEZlUADDfhXoPh3xCLSyuFkP4EZPrnPr/AIVzuL3OfQrftReNpLz4XyWabcSazaq/P3gX/P0B9xXc/DTxP/b/AIkm1CRstdFYogfmxHGu1Ppnlu/MhxXzz8b/ABE2r+GrxHI/cus8ZAG7cjZ9f8ivXfgNqi6ounsu54ZFUoQOoIHv7/Tg1204LkOWpJpo5v8AaS8eTab+13p72UdrJN4f0xHZbuaKG3jeSFPLLmVHRvm8vK4BfeFDKTuHl/iaa8/s7WNPt7i+uYMyXN87BIDdSxRNIZtgLIFjbB4JJGANpIz0P/BQHRL5/wBo23s0jkFrrmnWN9AVXd5hSI27vtB/gMUn4fhXDatrWmT6g1nouoS6hosdr9miklj8maZScvvTA2hiowuSdoXJJzWuFi9Ix6/8P+f9aHZ7aKpPm/rZf1/w56N8JdAXxHeaDoN9FqtnarqMUNv5dxEjQwPbtIzLLJ+7VPMjSYsV/dgFgWYAV3n7YOreLPA/iG68O3XiW18QaRNaW6T3MMBS4YgtIsF0WGfMDKGJXar8HauMV5b8NPF9joGq2C6xfCHRy32a/QBp5ltihDn7Og3TRNGXjK5UEtguoya6r4xeOtJ+LA8WeIJP9C1bUddjjttOvSGvVR4y5dQGZUGFXcQzHLADANbcko1lfVf8Ff8ADmlSpCeHtHR279lf/gI+d9S1Fbie6ZODJKQB6njmvUv2cfApk1Pw7ePDHJJJr9m8SOm4Ov2iJVBBHKsc8ehrycad9r8RrZwsuJpxGGB4GcAnPtX1L+z74j0XwV8fvhw13LDJotr4l0prhCcbI1uIxn0KghT17elfoHBuD55VsXNX5ItJd29/w0+Z8nm9VxUKUOrv8kf0D/A74RaD8J/AVjp2j6Pp2kWtuN3kWlusKgsxYnCgc816RBbrHtOd0cg47Zrxz4UftAaf4vupNN83zhkmG7ClVc9QGBAKkjFeh6F4rh0+3u49SuIoLWNg0ckr7MZycc9hivj6lGUZe+jrpz5l7p6JY+Fo4bL7QLry22BmBi3Bj37j86/KP/grrrFprH7ZbfZ7nzf7J0C0sJWPPktl5nHPrvjP4Adhj9D/ABp+134Q8PWptv7ZtZJgCSI5PkwB/ebAzX5MftGeKJvjd+1D4h1DdCIZp1LSJKksSRIoAbejFTgDoM88ZOK+u4Eip4+VSL0jF/i0jxuJozhg1GSacmv8yGz06W+/Zy+JYC/6RfeCtbWBDxgSafcRJk+rNu/Svzh+FXwz/wCF3eNtJ0HSr6HTJJrV55r3VdkNhpttDG0091cSBsrFFGrO21XcgYRXcqp/Rn4nfEGP4Y/sj/FDxUbV2WHR/sNjERjDTSR2duG9g0okYDkqGA5PH5aeWIJI41Zj5MaAE9fuDn9a9jiSSlXSi9bP9LGfD8WqD7X/AK/Q6zUPB9rs1T+wNWj17S7WXm8a3NjIYlLBZWhZmZFbIIycgEZweK0PAHwL1b4h2FxefbtE0fRYn+zy6pqF5ttvMP8AyyQIrySSYOdiKTg5OBzXK+HvEbeFHh1JUWRbe6zLEek8W354j7MpZfx+lfdHwZ/Zz0Se80vSNb0m01bSPC+kWcGlxXcG9ZZ5wbi7uiDgrI0jKuSMhYwO1flfGnFksjw6nJ6yvrZXtG1+VO0XK7ja+iV21Lls/oaOH9oz5z1v9nG+199a1Twt4i0Hxg1oZr670+zW4ttRii3FmkWCeNTKqg8mMsQBnbjmsDw5qC23hbUJWkC/aPJg9Mnf5n/tM/lX6kfBj9jP4aaT4h0nWNP8I6dpuqaPcC5tJrMvE0bj6Nggg4IPBBIxXxFrf7LPj7xd+0r8Q/Cng2EN4d0LxBcltR1B449KsrXLSIXlcFSFjkHC5OAegya+Z4J8XsJmNWvTr1HGFNRkpVeWL3s17nuvVq1opu9rOybzxmXOMU0vuPI9G1lUcKyH5hwa7N5FNrp21v8Al33Er82cu5rq5de+D3wkP2CHS4fi74igOJtQWE6P4fjkHVYlj/f3Sg9XPlq38JI5NPxT4j0nxNrf2u60FNHae3iY22izLBa2uUB2xxSI5wOf48mv2LK87q4ypeNCcYbqUrRb9It86W/xxi/J7niVqEYrdXPua48NXUv7Iv7OPh+yt5ri8uvD15fpbwpvkllur58AAckkRL0GTXOeJPgt4t8O6JcX+oeHNcs7O32+ZPNZSRxx7mVVySOMswXnuRX1D8DvDelp+0L+zf4fSTUvt2h+FbC4ii+zR+TtS1ubwl38zcpwM4VCM455yPpT9sW00XxB8NvDfh/VZtSt4/FXijSNMkaxgVpi5nEmCJNqlNyZbBJwOAa+Zo8RTw1WjQhG6neTet7SnJu3yPUqZbGrCc5PbRfJJHQ/C7Qf7J8V6ZYqfl0uKO0A9BDCsf8A7LXrjLtjx0rzv4af6b4xefH3lkmPtuP/ANevRZBkV8hiqjnUuezRjaNiFhg05TsjbPpSOOaWQYgf8KmjuOocT43m87XoV5/dxk/n/wDqrjdXjPlnB9sV0nimfzPEtx/0zjC/pn+tczrUhjhaniN0jCHc+S/2yPBs3izx3ptvHu/0Wx84qG6eZI6/+06K6T4sanDqvxU1SOaK3mSxgtoEMq8glPMbn6vRX5bnHsp4ypL2so62so3WiS35vI+9y328MNCMY6Wvu1vr2PyP+Edzu14txtQtIcjGMDNf0QSfEDUPgB/wTz+D2k6fpbapfTeBrIxxG48qMXDWcRAYDLNlnYADqcV/Ol8HmZvtzbfu2jc/Vf0r+kX4mfG/w/8AAv4GLrmtWul6lcfD/wAMWP2a1nugr3l1FaRyeSqg9SxXnB6dOM1/o5x9BzWBi6ftLzlLlWl2korXTrNH8kVa6p1K9Ny5XNRjfpvzP8jxP9gT9gzVv2QP2bviB4w+IQ0vSvG3xQ1K3khsopAwtbdJDJFbrg4aR3Z3OOgCjsa9EtJ9o69BzXyN+zd/wUh+IP8AwVr/AGoLPw/q6+H/AAjovgS1uPFljp1lEZ7jUJLdChhaVm4GyYt8q87O1e8/Gn46aV8Avg3r3jLVlaSz0O0aYQJ9+6kxiKFfd3IHtkntX5jxPh8fHGe0zFxdapaTjG9or4YxV99IrW716tn6Jw7OjHDOFFPlhpeVrvS7emm7suytqfB//BZHX9L+Dvxu8QNeas11PqUdvLb2Cwq9zHeSWsbyJACckRgoXdgEUvy2Tivyk+IniHT9OhkSOKKHUp5fMeKNvtE6jOS80xGNx7KoHc9MZ90/aY+LPib9qvxV4i+KXia58m/8UTfadS1YqEi8tePs1inRbaH5E8w8M7bhlitfMniG9sxELhoPs+mnP2O0BPm35B5ldjzszzk8t27muXFVJYegoXSaS17WX9flY7MHShUrSmtdf6/4b72jBvI2nhN5c/JHJny16tMfbvgep/CqLpJFD533eexq5qEN5fulxcKTNdELEgGAB0UAdh0wKd4htlt7hreNlkS3YQh1HEm3gsM9icn6Yr43ERcrz1027t93/l0PpadtEfdH/BLL9pz4V3mseBvhRD+y78H/ABh8UtduZ7Q+M/Hniqa1sLuVvMkj3xtG0cLbQsaqudzbQBuav1u/Zu+B2i+Dku4b/TfgZYeLLW1Vjp3w+0mW+eLABw9zJAm1h3IC/jX4Q/sOfC+Txf8ADn4/a42n6fe2vh3wBdFpLyON1t3kyFdN/wDy0yBtKjcCQeOte/fszf8ABUT47/Cv4X2OkeLpta8aW+hWscGj6Lc6hLos+niBQiNcNEoknUx7FxL8zBVO49/n82wznBSk9fn/AMMvuPruGpYmrVlRw8OZpXsrbK19N3vstWftRpHib95I0ibpmXAZvlYH3o8SfC3w78Qrdl1rQdGu4/LBxcWUTkZ78jPPNfhD8Wf+C5/7RPim9uoIb/SvA0c5bbFpWlKJUH+zLJuPHqBXy1rfxz8b+KfEs2qXHirxfda1ePvlu5NYujNI3qW39vwArx6eQc8bzkvld/5HrVeLJYetaEGpLe+jX6/kf0h3/wCxh8L0nVh4S0CNs4XFmg/IYrW0L4A+D/CKNHp2n2VjHnhIIhEoPrgACv51/Df7Y/xk8F32n2uj/FDx9GzsqhBq81xvb0CuWzz2r6V/Y/8A25PjZ4y/aI8K6b448d+Or7wrb3DT6pa/YndrhBGwjhby4t/7yYxRg8DLjJA5rCvwvyKUnJe6m/Pa57WB40x2MlGEYyd2lfVpX7/n6H61Xmpf8Kj+OFxNoOpHTbPUrGxk1lRnySss1zFKzDpmRYLaMjqPOLdXzX6jfArRP+Eb+C3hOx/s2HR2t9JtVksIv9XZv5Slox7KxI/Cvwg+DvgXWNAk/tjXNcvtR/tOeS8ijkumkjsvNjUFJJd37wggIMgAYKjPSv3Y/Z21P+2PgL4NuN2/zNFtMtnOcRKP6V05fiIypKjFP3Vu/n+R4fF+FrQkq1WSfM+nSy79z5T/AODi++On/wDBIH4rOsM0hYacu5F3CL/iYW53N6LxjI7kV/Ivrko1DVpH7qxGR655P51/WN/wcw/FDw/4N/4JMfETR9U1iKw1fxGLODR7Xzgsl9PHdwylAucsoVGJ4IGB7V/JdbtwhHOADXpLY+HWp+kP/BIz/gl34G+JXwluv2gPj5r2nWPwn0n7VHb2F3O0a3rw5V5JWyDgMCFRMljjqeB9VeI/2XP2R/8Ago7+zrb6h8Cbax0Bfhz4v0+HVfsmnS2F1NbTzIj+es4VzDJGHKuehR+hBA4T/gmV8Q/g7+3P/wAEgtQ/Z5+Jni/T/CGoeD7yWeSe6uorHyYHuTPBcI8hCyYZ3DDrnggDBPo/gH9hr4Hp+xx8ZPhL+zL8aNN174geKNKt73VNRttbjvbgRWLPIIz5WPKjdi4O3kFielY1pWfX9LHXBK12eR/thf8ABX7x98XvEHxx+Fngb4YaNovgH4c+Fta07V3v1LXKRxYtoroLgJFh2Tag3E785wOPye0rwFqet+HoprGxvLyG3yZGihaXZudI1ztBPzNhR6k4HJr9Wf8Agmjr/h+LwLqn7Dvx28G6xoPiLxYbrVpLu61FY7iaWcQXcVuSnzAeWfMG5yWfzAwGMD9BP+CS/wCw03gT/glb47+E7Q6pNd6f4t1dr6aYQR24u7PV3MPlM3Mkj2sVuxEgaMHaMg5A0w9JNuO2id++qVzHFVFTSk1f/OzZ/P3pvwW8ReH/AIU6LJ4l07UtLnuLi4t7WHUIjHKkC7GjJVvmVSTKFBA4Q4GMZm8Ntc+HF+wSKklsxB8ieJXjIzj7vP8A9avvD/guD9s8EftHeC/CGpaPcaPcTeHy2nF0gVbyISz3EEyeQSjbhmIbSSGdlzkYHx/L4ch8Sad5mVO4DBVDxk+ueteTjP3dXlexphZOpS5tmbfh74I+E/FthPdXWhWkbX0fkzyW8jQeahxnOCPToB2rbsv2X/A9xPazSadfGSx3C3k/tB9sWSc7dvQe3ua5/wADajqPhKNbe5/f2asdso42Y65/D+Ve0aPdrqthFOrNH5ijG7Oee5z9a8XFVKkX7snbyZ3U4xejWp5b4l0Pw34N16x8G+C9DsdO8SaxbSD7WkRea1jVWKRqzHKs+GG4H5Rnua5H4cf8E1vi58XvDU2tWfh3ViPKWRpLyWO1Em/p5asxbABB3NgnOcAYFfUn7Mvwmt/Ev7XWmtdaXLqLag8LG4hk2z2CIhQKi453MSxPYCv2Y+Knww8PeHfBskWlW1vaiMi7YSyqrSIwxwO4BGK7o0pwoqcHdtJvv/S2O/A+ynPkqLrZdj+cfQf+CYnxjm8QSafc+GZtsbbTcS3kKZ6YwwY7sfyNew6Bpvxw/wCCPbWfxR0G3s7zQbp4tN8SacszTW2oRMTtWdOhOcBJByjAYI3EH9LPHnjjRfCVtNfalquk6NaQ3DRNLe3KW8YwAeSxA6GvFP2q/Gnhv9qv9iL4n2PgPxD4f8X3OiWy3OoW2n3sczR26kHzAAc4BGd3Q7SBzXzNTNMTHExlL4bq+mlj7KeTYZYWUUtWt73O68M/tq23hv4R3WreGdEfxRD4q0OLxd/xK4CnyzLGskjxEKx2lwDtycxOcYViPx1/4KKftGaT+0X8arXUtDtdatbLR9JjsJrfUthkW5EjvNs2dULEAZ5r074BeE/Gnhj9km11vw42uDw/qFhd6Xr8tgt1IShvWdUChTF8hjQE5IQTScAsc/MfwY8IWuo/Hrwzod7G7WNx4isrW4RvlZoTdRhx7ZTP51+jYZpUW0uvfV/I/J60WsQ4t7eWn3nefto+NZvDemfD74N2cnk6R8L9IW4vov8An51zUES6v5m9WXdDBg8qLfFeT6HfbZowx2xocnpljVH4g+PL34nfErxB4o1DDah4k1G51a5ZQApknlaRuPqxpmk3Ef2hVZtgYgHPQfXtUqNoWK6ns/hTV0trGNt4PQ4H9f8APaugtfFYiiJDLubALA//AFq888O2kiWYeIRyRtj7pxu/EcY/Ct2xg2jc3nJnnDAHGfSvPVkbamN4/u5L6CYeW22VSpG0n8hXrv7KM8z+H9Lj2sHt4lQjucAcH04zXIrbwCCMy+SWzk5Ujf1xjnHau8+A3nHxjdBVt5o12SrEs4UhQo3HHPQ8ZraE1yteX/AMalm0ZH/BTi6jTxJ4HRVt2EmlXbjK7mKPLGMHtwVbGOhyfSvn7T9Zk1K686UQphFiVUQRqqqAAAB9OvJNe6f8FJbDdqnge8mgW3vpLG6ttiz+crQJJG6N0AB3TSdM5GOelfPOiu6SrxXVg7KKa8/zFPWNj1vwT42k8L6RqVvDa6bew6tam2kW6hEjwkq6rJC/BR1Ej4IIBzyDxS6t8QNa1TSpLO61RnimhgheEQosGIAixFIwMIwEafMuGPOScmuX066mkjA8mTGMZxxUmo3u1CGZo8cfeHPNenyxer3/AOGOaM5rRPT+v8zH+GuiRp8Skt5NpWESMu5c7+2fqQSa9+0WSARQxSWtvI7Y2gxh8Ec5B9sZz7V81vq0tr4k+2QSGGaIAxvnv/ntX2t8Ef2SLn44fBPwdr8Gualo954igju55PITYNk7Kyx4Jyp2dDz646V9RkvFWCyrAyp19JNtx3s3bRNq7W2uj8jhxOS18diIuntZX2ulfW19Ovc+yfg94s8VeDPBlvNb61rFxqKWKfaZfN8zzWCbiuCOADxx2rt/2KfF9z4l+Dvi7X/Gms6pqif2w17DqutK9svlyRgNDGsjHYI2jbAU4IkVv4sV4H8JvhVcfGb9njRNW/tDxta6pqdjeXBMt69lK00czxKvlx7cJ8gxjqMEnmvFvBfwMOkagx3ahJMshWWKe5lkUSDqdjMVz7kZ6V8hwzkdbiHD4ulXr2m5Ru9W0ryvaN0kn01SWmmit9RnudYfJZUZU6OlmlayV0lu7XutNT6X+Ov7UmgazYXmn2MNzqUaxO1q1pP5cjEcfK+Qc+nrj3GfCfh1qF1c2ZsnRo5LhiiNtKmQf7X+0M4P1yOOT3Hhj4OXF46tMjNzgnd27Yr174TfAG88QavHBaxzanNkLHa2yG4nYk4GEXLc9OlfrfDnDWX5BQmqEnKUrc0pW6drbLW9tfNn5fnnEWMzmpH2yUYxbsl59Xd6u3XT0PO/2k/2eLr4v/slW/hGHWv7B/tbVra6uJjbmczQW6O3lYyNuZXhfPP+qIxzkfKt3/wS8mhnZ18RXt4MAHyIoVYcY6Mc9vT8a/Tb4n+D7jw7rcmi3lrJazaKvkXNrOm2SOXguD3BGQMe1el6P/wSY1jxhpdvqjeMNH02C+hjuFgTTZZmiDqGALFwCfwr8w4g4ilPHzlSkuVaL5b/AI3PrMpwHs8LGMt938/+AfjH4j/YAuPCdtBPDr980kN0kptLzSdhcBgWxKJNmQoONygE4HGc19H+HfiVHqvjCTW7W1vLe11CV2Frd3JuriAB2AWSUgGRtu0lyBuOTX6QJ/wRe1K5v9PaH4sXVjDBJ5lzFBoiSJdp/c+dzt+oravf+CJHgnUnWbWPEd7fyRyLNvSwS3csOhzGw/XNfmvGGH/tzDxoymk4t2uu61Wi9PuPWo4d03dHzd8FfEy+N4o7bSbjybmQfvHyFkgHque/v2+tfGX/AAVm/aIsfBWv2fwD8D+TpOgeH4I7jxEloPLW6uZQJUtTjgoiOkrj+J5QDko1frJF/wAEq/AHhqXzIdW8TBu3l3Cx7foQMiuH8Vf8EZfgX4x1FpNb0XUtYuLqXfJcXN0BcSMx5JlVQ5PuST09q+L4F4BjlWarMMc1OMNYRWtpdJO6WqTduzd+g8ZUc6bhHQ/C3wVpG9Wk6sQduenb/P4V32pW5u/GElugP/HwsIHtwuK9W8bfsuWXhv4p69Z+G7Ce50Wx1m4t7UQXaXzxwLMVQPsYsGCjneAT1xVr4Z/C6DxD8d9HsfJkWa71u3h2OhDczqORiv6tp4ulCLmneyb9Ntz4yUZc1rdbH6X/AA8vdJ8Gf8FFpH1jVtK0Wy8HeEUsIp9Qu47WETDTorYJucgbj5r8detekftEfFbwh8SPjh8EtF8La94f1hofE91rN8um3kFwYVtLJ5kL+UzbQSrgZxnBxXxf+2feN4j/AGq/H1yvzxtrU6L/ALqEIMflW3/wT50Zrz9qG0maMKNM0i/uR9Xh8j/2ua+Up5HTdCnj5yfNCkkl0vyNfm7nrSx0ozeHS+KW/wA/+AfpX8E4vNubqQj7kCr+Z/8ArV6BJg+9cd8ELExaVeSFfvMq/pmu0eLI/GvisRpVaPco/AQMM06ZM2bN7iniMt/Opr2Dy9H3f3nPH0q6C1uTUPJdXfztY1Bv9rb19MD+lc/qyNIjdCO1bEshKXMm3O+XP15J/rWZduFcFvuhsn8KxxFT3zOEfdPlbxc/9p/ETxNMis//ABM5I8qf7iqn/stFQ+F7l9Rtby8YBWvr64uCM4+9K1FfjmKrRnXnJxTvJ/mfplCm4Uox7JL8EflT8FbGSawm/u3A8oZ7dq+4/wDgo5+3DceJPhLqWl6Tc5k8QX4jEsBP+pjQKCO4UgLjp09q+I/AAXRvDaTfMflIYrwxycZz/Wsf4peNr3WZYbe4maT7NGIsbicbSePpzX+ueJw8HGDmtYrT52/yR/FLw31nH83RP8j9B/8Ag2W077V+0z8UruSGORU8AXcbXBHzQs9xBgKexYA/gK7n/gqjqlr4k+C/hXwvqV3Ja6Jreti51YxE+ZLaWsLSNCo6kyuY4xju9eFf8EN/2htP/Z51fx1c3+5U8QQQ2EahNwYAseT6cjj8a96/4KCeF28T/CjRtat7SK+vtDvvOiSSXy12umTz7MqHHqBX47xtgqlPOaeJqL3Zxil/26tfxaPuslxznSxNCO9Nrr3t/l+J+Zv7dviebWbzSfDNvYwW+9Y7l9Hth8oVRm2t22/8s4kDSv2yYwO5r56i8CR2Umparr0kkstgEDh1wrM3CBe2OPlA4AB9K9n8f+L77RfHHiDxDfafcy67qiPDGTAPLssqFLJng4CqAOnzMab8G/2YNS/bS1zR9J06+ttB0izuri41q+vbhGMMccSlZWUHczMSURQMffwAAa+Qx1GH8S12tu39K/8Ake5garjBQvaPV9e7/wAvX0R872zy6jd3WrSALHp4CQ+jTyZ2AepVcv8AgtYtzFh1VWVgSCTjpXqH7SureG9N1238I+C7W+j8M+GHkhkv72HyrvWrwnE9zIv8KkrtjQ/dQDuTXm4YStEvlou0kbgMEj3+nrXyWJjf3N+/9fckfTYfVc23+X9an1b+xhdat8Mv2DPjp480u8tLe4sNX0Cwto51V/Mn88TKwU/eCmPDIQVYHBrzbxh+1P4s+Lv7QcPirxFa6bcX02npY3Eem2f2ZZoo87WZdxDMAcZJ6ADsK9E1K/h8Mf8ABJfwvZG1tIbrxR8Rb67jnikxcXcFtbom2RccoruNvOM5rwnwXcWVl41t57u7hs/kfY0jhUZuMKxPAFcuOw3+yTmt1t+H/BPpOG8Q45rh0p8vvLW9rfee8eDfAWh+L9Qj2XWlX8dwB59jdgK6E+kb4OevI/rXdan+wP4NutKt7xbabT98qJIYLhgBuZR05x1J/KuZ8KyWfiS2Ecx0zVEwSsoVZC2M5IdCcHPHP9K9U+Hml6fD4S15o7VrWf7E7J+/MsLbf9llGOnr718rSqygrQbXpdf195/VkshwmOw7qV6cKmm7in+N2O+FP7APg74U+IrfXJn865h4t2upfPFuxz0jxkv2BwT16V7jo15aW+iSJp1kPK+61xcYUPweNo+uACf/AK/K2N/Z+H51u5pVLyQpKXvLkeXEx+ZmDkjbnOfw6+tTWP2k/B/hqDzr3xl4f08K2XtNPmErSsAPmJUMxOOOMHPfiiop1Ja3Z7mHrZZlWE9jT9nRhva8YK/ey1b03fY7z4FeD/FmragzTar5NvdJciO1u23pb7Y90MkKjHzKU247g4yCc1+7X7EGiXHh79jf4V2t4268Twppr3JI25le2jeTj/eY1/PR8MP23/B/iGDxLpXh+O81jVJLCXy5LjTQkI3q0JfzZGMmUMiyDaMkx4JAJr+jn9nr7X/woPwT9vgW2vP7BsRPEpJEb/Z0yOQOhqadB01JtWu1+F/8z+cPEzOMBjsevqCVo3u4/C7pNNdO6fmj8Sf+DxO98JWvi/4XWsc91N42u4LmaeI3j+RaWS8Kxi+6Gd8jPB+U9a/BSwO2H5sdBX6xf8HX/hrSfDv/AAUQ8zT/AAvY6FqF7oUdxeXkV/DM+r5yFmkhX54iMEfPywGRxX5PQIvvtxXTLZH5lHY/Xz/gl7+zD8F/+Cgf/BLLUPhrZv4K0H4xW5uYdT1ZtJt5dbijNwZYX3svmNE64XcpOAMZ4wO9+F//AAS58P8A/BFX4DfEz42eLfHk2u65H4Xn0XSVtLc2cKTXJCqgBOZGdwigcYG7gmvnn9lnxX+w3+z/APDLwXq+uDx9qXjy40PTJNdn0/V9QtJTPNYiW/t1a0u4AiC4DIq9CqqG5Ir0PUf+Cj/7F/hi7M1p8EdN8TXVpAuX8SxDWYpXMzbXUX8tyu8RrtY7A2CpznisqkZPa51Rsuup7p8Hfjv+zr+0b8Wvh9+0ZJofiDxt8dtT8PW1vc+FvCVpNr174fe2V7aRp4LdSsBIz+9uCgKldpwM1337I/8AwU48WX3hDxdpt1HdeH7W88e63eyLAUttQt0N/MJIpmUHc4TaoIbK7AoJAFfBvxI/4L9a9d3l1pfwr8D+Ffh74bjMb2yWmnRbkljeVo5UjCpBCyrJsDLCzOoAY4UZz/2Ovi/rfj74Yf6TNcXmratreo6lqMzyFnkM85kbDN1ZiWJ9vSvTyHC+0xDhJfZf5o8TiLEeywqnHpJfkzF/4L2fG2D4hft3abqHh+xk03S/CulW39mBpmkkkjE8k0czk9HfcGbHGT6815T4FVfEcMs1qq/YbpFniAI/dq+cD/gJyD/u1N/wUv0VtR/ak22ca2sVxpljGu8bVkZYzGzdBwXVufWuf+B73nhXTWsbiGQtCrJD8uQVJDfoVP6etfOZpRdOU6d7tN7+p7lHGrFWxPKocyT5Y3stNldt/e2ehaWyaaHaeNJF+4D1wexH16Z5rufCtw15a+ey/O5JGEJA5zj/AOt71xGna1CL6G0uJ5D9oYgF8eWp9Px9PWtqCydrSSWSZbbR7Nd7l5hAhAHd2IVQT3PAH4V8zWj3O2nJX0Z90f8ABOPwLo+teIdC8aWN4kfirw94hFr5PmvIupQvHvkTYF2oI497by2GOR1Ars/+Cp3/AATj1j46+NI9f0WPT9SuNWvVUHULZ7q4C4b5BJJJtRFYoqxouFReBk18F/8ABP7/AIK6+Cf2N9V8a3/jiGbxZp/ieCOO30bQ7cGTSJIBIqGCZyABIsjrI+QWyDjgAfqn+218dF8e/sz+CdY8Lyatq3hPxoLK++06PC09/NY3VsJUMKKQzSMhC7QQwbK9eK7GpwwvLO/Zf189z3strUp14OGjtrby699bL1d+jseUftMfsTXnw9/Zi8F+F7G30lvFEXh+2kupZ7Vb5VnikKzeSs27YxjKBTgkAcCsb4W+B9U8UfsteJPDOsagdR1RtBnsk1OWzht7mzV0Kyxr5YH7sjaduAMopwSAa9c+Muu+KPEMFjcX40bT/CNlYR2lnJqL2iXlvDtR/LEG/Kn51IUrvDM461zP7O+rW/hb4Q+ONYudOv7PS7GLZDBrEWy6ilGcwyLlvlYNCQCSV3MD2FfJ5pC2KlTh3VvuSPtsJKH1NVKurV+t1v117fqeBfFK1sfhL+zVo/hnwj8YLr4X6HpenhIfDkltGgJKEySMxXEjSSb5N4JLBlz1r8kv2fbKa4/bJ8Kw29wusXD+KYGjmUcXjiXeDj3I6V+on7a3xxl8VeF7pb/wNaQ6lI66Xb3FndRbblHEI8uJvJ8zY/2q2HVMh4xgDIP53/8ABO/Q5tM/4KsfA/Tbqzkt5oviho1vNazAMY/9OQMjY4PBIPYivtMhw1WjQcam9tfXqfD8W46niJxlTta7tZwemn8qUv8AwK7/ABPmVBs+zn5h+5XJFXJ9y6bN1+7371c8Q6HHZa3qrWzRi1sdRktI0L/NsLybCB3ACYz249ar3J8vTJSP7uPzr6BNPY+PlBq1zMtZpLJ1aGSSFx0aNypH5Vr2XjzWrJMR6peY9Gk3/q2axnG0c0LJuLH+EHAqAsdQvxW1/wAtVOoeYB2aJT/SvWv2U9a1TVtQvtQe5j+0tcxwrMUzIQqZ2jBACjd0xyW+leAiTC7v4VGTX6afshfsoeE7f4CeGo9Stbn+3W06HUr2WK5aNg1yXkXIHHCkL05CiuDMMZTwtPmmt+x3ZfllXGzcKVlbW7PIfj18O9B+IviDw9Hq0N5Pc2lmzNPBcuu+NnZVhAOVUKyM3y8nd7VR8L/sLaHrV6jWd1q9vHIejTK+Onqte2/HL4YWPw++IOjW9n5sljdaYsitcMGcSLPKrLkAZAGw+vzV0HgTRobuJdkbbV4OM4xweT+HSvLjjpTgp0m0un/DH3mDyOhChGNaCb6vf8dzjvD3/BNXwjcTru8QeIJImPKhol9e+DXdxf8ABO34Z6daKf7P1TUGXk/bb0yKT9FC16R4e1SHTw0eyOP0xjjg1uS60qWTTyM22NS745GByf5Vzyx2Ilo5v7z0KeT4GKvGlG/ov1Pyf/aV8L6b4R+OPifTtKhhtbG0nVI4IeUiwOR7V+lH/BGf9ky8l/Zb0nXp9QtVj8WXFzqlqEY3SQr5nkgBchUlzCxdR/s55zj8vfifra+JfG+vasrNsvL+eVQ53ZUucc/TFfTH/BM//gqt4k/YV0hfDuoacvi/4e3l217LpUknlXWmSyY8yW0lPA3YBMbfISMjaSSftMPg1Woxo1VzWSevfQ/Kcfi508VUq0Hy+89rbXP3G+E/7JHhPR9IWG81TX79fNkuTFFKtrbpLId0hjSMYRWYsdoyMsx6nNeIfHn/AIJd6x4t/aJt5vh+YdN0HXYPtF2l7O0jWMqk+bIx6+Ww2sOM5LD0rtP2aP8AgrT+zr8c9LtTY/ErTfC95N10/wATxnS5YmAGVLt+6OM9Q+COa+j7P9o34VxaI9wPjB8Idl8R5tz/AMJrpnzDPAP7/OPavSyzEVcsrOrhYqLattpbztbZ6nhY5fXIcmJbavffr/w2nofPvwY/4JZWOkaZLfeJL261lo5QlpDvMEM+PvMwzuK+gyM194fs5/DPRvg/YaeuiWdnp6y7IZY7SIRRv9QByc9zk1xcX7SfwebQIYbT4xfCR44o9u5fGWmkHPU/67vg12vwf8R+FfjKiadoPjXw34gl0+WG7lbw/r1vd3ECJIGBbyJGKqSApJwCCRmufMsyxmMXNiJNq+3T7ti8Dg6FGajBJee7/wAz84P2kdV/4Sj9oLxtdMP+PnXboY9MSlf/AGWv0B8OoLLwVpMH922iUj6RqP8AGvzMuvjf4H+KH7Svi3w/ofi7QdT16x8VXtlcaZ9rSK+WVbx1ZRC+13wc/cDCv001W6t/DttDHeXVjaCGNUzNcxxjIH+0R6V8jirp2Z69Pc2NJ1VWnEbLhnGAfpU2snzbCTaCOcCvO4f2gPh/Y+K4NNm+IXw/j1SSRo0sP+EnsWvGdQSyiASmQsACSoXIwemKw/Fv/BQ34C+ENS/s3UPjJ8ObbUvNSAWn9tRST+YxARSiZOScDnFcX1as/fhBtd0nY6Y1I/C2rnTeJMw4zkZzXG+ItR/s22kuM/6hTKcn+6N39K8t8af8FZ/2dbyCKaD4raDfoqud1lb3NwZArbWZAsZLqCCCyggEEZrxz4x/8FiP2frfQdc0yx8cXGoax9imjit7bSbkkyNEdiksqgZJXr0r2cFg8RVSUabfyZ5+IqQg3dn5yRy/8JJ49a4P7ySa/eYsR3Mhbr2/+vXsX7Feo6j4s/at+H+mNdXFzZz67A4inbzljVX3nYHzs+71XB968J8A+LrKbVYWVpHMaPKxI5yEZjmvev8AgldqMOu/tueEzhhHpdpqOosW7CCxncH88V+kZxTccHWlbaD/ACZ8ng/exEG+sl+aO8+KXxU1PWfiV4gvI4dJVbjVLmRW/sq1diDK2CWaMk/UnNexf8E5dZ1TxR8XvE32qSHyLTRkTbFaQQjdJcxY5jReyNxXzbZ3banJHI2T537x89y3NfW3/BKbQlu/Enja42DDy6baK3rg3Lt/NaMdThTwE7RWiS280jopylLER17/AKn3x8PdB/srw4qlcea27p1GBW01tjH51valoselx28Krt2wKePes+5VU9K/L6y/eNn1dPSCRnmHYf0pviyX7J4XU99jvUk9wq9KyPiDf58PtGCflhx+f/660o9SKh5UN32NT/eYn+Vc744vzpXhbU7rp9ntZZMg9MIa6a6j8u2jX+6uT+JNec/tE6g2mfBfxNKv320+WJOf4nGxf1YV5uKlyuU+1/wNcPDmcY9/1PA/BOmMPCunqSwYQIxHuRn+tFaWnLHZwLH/AAxoqDj0FFfjsZWWj/H/AIB+k3l0Pyd1ADT/AAS6hdrbRkg4Ixj8j7VxOsA6nfFY1bzOGBx8zE9eO2cj+VdT47m+zaUsKt+7ztk/h461heCtFl1nW1XkeauG65I68nPb24r/AGCre/PlR/F+Bap0ZVpPu/yPfP2VdPOl6L9nhjYtNKZJM4ChsKefyAr7S/bou/EEX7I0l74d0u31m6txbyzwS3Pkq0JUBsEAksc4H15r5k+CHhG38O+FRuRY4l6u3P14PX19819s67ei/wD2Upr5WDJNoKSEvGOR5YzlTwOnTtX594ne5DBzttJr70v0R0cFYj29fGq+6TXyb3/A/IOTWvFHx5ubizj8H63osenYWZlgM0FqvVmYjr0ySawPil+zzq3we0FvEdjrum6pbgGOdtMvAtxADxh1U71Bz3GK+yv2aPgvrHx3+J9x4a8N3Gn+ZqU5bULO4gEkn2X5TwQd4DAbSMMp7969r/4Ke/8ABMjwH8KP2TNY1LQvh/pGj69pKLcPqtlLOrSPxu3bXJjABPymNlJHVQK/LM2iqbUFL/P9PwPtMrx3Mk+XlXlt+Op+Jl3pi+JNSZrOaZrqdnZkmkJJwCzMWY88Ak5qlpkVxeXUMNvFJdXEzrHDFEhaSd2OFVQOSzNgADqSK6bWvDl1bGTzdOnumnVRDME+aEhgTgxkK+RkfOpPPY1vfsxfFu3/AGc/jPp/ja48Ox+INV8MiW60awuo91tHqQRhbTzr/EsMu2Xy8HcUUcV8jLDtTTa9f67n2VOquXQ6z9sTxnF4M1jwl8L7FoJLT4V6Kul3sqSbo7rVZmNxfSLgDhZJBFg5P7k/SvD/ABJL9r0b7QyFVaRUQhflyM55re1NbzxJ4rvLrUFTUL3UJ2kluLuYxtNK7Au+QeWLEnnI5PFbnxP+GWoaV8KJL+SHVLr+z54453ki8uGwQkgBV6kHI+fAHI65FTX55YWbltZuwc0VUUepwPhhtl2rR71b1jYq35g1212upTaX5cmpatLbsMmNr6WSLnsVLf0NcBoUzLKvuQK9F04rJprSBmjlVfkcPuAOPRsgj2IrxcLFSjqdsq04aRbSZU0vfp6RmdmaPGET74kzwevQDHTpz9a6nSWhuPlO1cf7I/yO/wBa8uvItT+yf2zIu6x+2Gw81ECKkwQSbSBwMqxI9dreldD4T16RpYxI7MrcYJzn1Ga6KdS75TPme5618G/Ei+APjNp14zNDDMzW82BhSjqVP5A5r+x34Va7H4n+GHhzUo7iK8jv9MtrgTxjCTbolbcB2BznFfxhazCx0u3vI/lkhKgdxnj/AD1r+oz/AIIF/tGn9ob/AIJoeAZLqcTap4ct30e5PciF2VD/AN8bR+FceOp+7zdjenW542Pxy/4Ou/CukW//AAURtdU021khm1TRI7a/kGiC2huJowRn7TjNzIFZQSc7AFANfkZbNhVHcDHNf0Uf8Hdv7MsniXwD4F+Jy3EcMXhuV7GYTzXDeaJCu2ONRmJDkZJwpPcnjH87t7afYtSnhLBtjnkdPUfzrgeyZUXfQmgwFyq8Z64qR33OcevTOaZFGu0dME0pRQ3fj0q9dgNjw+2Ay5568elf0jf8Gqnwn8A+Lv8Agnf4gvZfDejz+KG8RX+j6pqLpvvJrWSGGRIg/wB6KPbKV2oQCULHLEmv5tNClWObPoccnt/n+df0b/8ABo78XfAbfse+MPCtvrMCeOj4okvb6xmYRtLbvBElu0OT+8H7uTOOQc5GME6R5lBuO9unqiZuL0nt5nE/8HbP7N/wp8If8E8vBt54Z03w5oPiHwT4vtre0s9Kt7aKQQXUMqTiUKvm4JSFtxOCyrnJINfz2eHPit4k8GRtHpmtX1pGwI25EgTIwSu8Hbn1XHSv29/4OKZdU+Mfhb4zapDateW/h6azMxSLdHbwW99bQlyV6YaVRubu2D7fhbcWn7xvlC1tmGXumoNvm5km79zgy7HKvGTSsotpeisXr34ieItUfdceINcnbOQXv5Tj/wAeqHWfFereJ41TVNW1TUlQ5Vbu7knVT6gMSM1e+Hvw21z4q+NNN8N+GdH1TxB4g1qYW1hpunWzXF1eSH+FETknv6Acniv15/YZ/wCDSbxN4r0u01z9ovxZP4FtbmP7WnhPw0YrrXZYuARNdSbre2IZk+VUmY5I+UiuD6vZXdkeh7RI/Ij4bfC7xJ8YPFUeh+EvD+seJdYkUyCy0yze6m2Dq5VAcKO7HAHc1/S1/wAEmvg7r3gz/gmD8H/D/wASPD+paN4l8PRX9i1nfJtukhj1O5ms5AueP3MkQXvhBX0l8I/2Uvgr+wv+y9qS/CH4c6H4Zso7Jp9RezjabU9QWE/aHS6upS087KFlwJHIBUABQAAfETxnB4m8BaLrOkzRvHcol1byRtlXU/MMfWvMzCcY2h87np5bFyTnt0/r+u58j/tQeKobP4/293pMK3/iJFVXkkgBWRskKWGMq2MZ+grtvFHgqbT/ANnO8tdWaL7Vrl5DPqIkjVmlWWaMS8srBHZRhXIOwhW7V0mv+JrPxx8WLO9C28jeWGDAANGckEN9D61qfGDx3p/gP4f6pq2oQ/bI1iO2FTzI204A/wAa/Pc0xKji/aws7NNdn11PvqMqlbCxoTvtbz7aHyT8df2T9I0UaTJd3moava6JYeJZY9W/e2OoWV3fT6UltsC5T5LO1mt23bkK8FCGIH5dfsQ+CT4L/wCC1Xw509by81AaD47h1E3V1EIZplt1a5LOo46IeRwQMjHSv6EdP8MWvxh+Cnhu51DS47iPVtJjmuIpM4VWQMVyMHvjPtXyHff8ESvCug/tXWfxm+HPiLVtP8SWOn6kn/CO6vKLqxvbi40q5srZoro4lt/LlmjdhJ5wYA/MpAz9pgs0hKFpq1/uPgcTg581k72uvxP5+fB/hHV/iR4o0/TtK0691bWNbuvKtbS1gaaa6mlb5URFGWYk8ACu6/aC/ZS8cfsx6vFo/wAQvDeoeFtSurQXiW12Nshj7Ej68Y9a/aj/AINXv+Ccep/Af9sj4qal8TvCraP44+GulWmnWFrfRrI1q920ge6hflWDxw7UkQ8rI4B5IroP+DwH4J6V4l+G9l42YKur+G4bOCN0QBnjmnKFGbqR0YehHvXof2hCMFJrRyUV8/8AgnQ8t99009VFzf5pL5a/O3r/ADvpA07KiruduABVVfkGK0YomNz8v3ucY9e1ZnUiuo8kmb/UP/unt1r9bPhlo2oWOj+NviHo99b638PbzU9F8E6Jr1iG+wX15Z6f5tykO4Biqm5xkqASjc/Kcfkmg3Cvrb4CftpeLNY+CfhP4Yax4sm/4RX4b/2jdeHNHeOGC2gku5XuZm3IivLI0jPhpWcqrlVKqSK8jOcO6lDmjuv1t/kfScM4qFPE+znZKXXrdXsl9/4dz6i+Per/AGG+03V9avo7OxsdMnuTIU3NEEZC6kHPO0oQB1ya+drn9p/xl4kmmh0e8k8P/bIpJtJjNlDctMq/dWTcrAMwBJC4xyOvNXP2pfGi/EPTtU0GHWrORNW8SJqStA4lWLTJLWFVXcM7T5sI3JkMNuTkPX1b+xp/wS18Fy/DnT9c1O4vtU1C+iS4jkd28tBjIIAOMg5/M5zk14VOjOlhk577rTp03/4Oh9Tiswc6iw9F6RWrXd+nZee/ofK/wY/4KBatZ+MLfQviFpVvZmR1ibU4lMHlknAaSM5G3PUqR9K+i/jj441S28PL4d0WNjquvN9jjlPypAG6vnuoGSSP4Qcdq+qbn/glx4N+MnhOXS9Wks3mmO2CeWzj8wOc4OVCncOxBHvkcV+eNj+zn4v/AGffix40jv8A+17nxDotlLonh20mlZlS7uJkgjdVZipWON2kGBgLH9Kxp4uNfnVlCUVfunql5Nb3e+lzfCYirQtTn+85nZPZrRvXTXbyOk+Lv7DPwu+FX7Lt1eX2h6lqfiC0tMrq9rqU1vcyyryHaEs0DK390ICBjknNfCP2A2E8tr/FAxjyRyMcc1+qH7d1ta+G/wBnPVPtUwj8u3+xwKf+W0vCbVz949ckf3T6V+cXgzw5b6w0zTDdJhWbnnJUf1zX2fBUsVUw9StiW2uayb9Lv8X/AFY/PeMHh6NWEKKSdru34X/EyvBlwiXwWbzR5ZdmCYLfcI78Y9/StSG/RVXaqrx90Qow/lWf45tx4W1DzrVmjkhOPqvII/X8Kp+H9Q/t5F8kurZxt3YIPftX3OFrKMuS58VWp88VUsdt4d8SiwlIjjTbICrqtmnz/XkZr7I/YI+L2p/BX4g6b4u8Lr/wj+taW8UkVxas1tuVWBaNwrEOkgGxozlWB5Br438K+Cbm4lWZlYrkKOlfSn7OUD6drFsoLyNjG15Gx04+UEDr613V4xnSd1qeVUqck48j6r+v+CfCfxR8fXXxY+KPiTxZfRwwah4k1i71idIs7YZbid5mCk84BcgHrxXvn/BIH4by/GX/AIKX/B7TZ4JNUt4/Ethd30Ly75Z7WO7g89UDHLN5bN8o5Izj0r5tu2+y3V5CyrnzXTgY2kOentX1d/wRY/aC8F/sn/tmN8TvGkk3/FB+H7rVdFt49hN9qAuLVFiKs6b/ANw9w4UOp3Rqc4BB+BldppH2u5X0bW3+DX7euqeLrK/0+68Wtrl1ql1JJAZ4tJa8aSR0O0gSSKk20hW4Oeh6cjrHjy18Tt441XXNZbTfFNxJFeW4jtJB5rblxFC6OVHJLkPkLsGGz18v0fxQ+o+I7zUbme3t7u9lMkohtlhhyeu1Y1AUdeij8a3Nd06SfTLd3jE0bSvIZY23oRhRnIzx1r7KnTp1cFGkptPmvb7Ltfpvd/8AAPInHlxDqNbq1+v39vI6TWfiFqHxQXS7G4mSSPS42t7N47SGCZjIRzJIiiSUjCKpkZiqqACBXaX3i++fx1qIuJrbVrNryXyodQgW58pN5wEdh5kfGP8AVuteZ/DyFf8AhItN2r/y9xN65AcGui8NSfadWLN/fJ9e9ephcPTjJRSRx15PVnungK50uZbpmtbrTZIbKZ99vL50XKbT8knzL167z9B1r6g/4JS6FDafGfxnrVvqVpcLpHgLWZQZA0DQPJGkKlgwxt+cjcDjmvknSrJtL8OapIeDJZxoD0yXni/9lV6+rP8AgmXF9j+D/wC0FrjKN1r4WsNLVs9DdX6Lj8krnzym1hZq795wj/4FKK6+pz4C0q0Zer+5P/I6608FizC+ZrHh2FUXAxf7iOOOAtfZP/BL3SbfQvCuo3kV/aX327XxveBXCr5cSDGWAz1PT1r4Q1S5NvbSMuOuMZx3r7X/AOCcVy2lfs86TcM3zXmq3k/1AdUH/oNcObOSwWr3kl+p0YezxG3R/wCR+jHijWEur/cvaJFH5CucvtQMjdT+NQPqDS20TMTkxqT+Qqlc3OWPvX5hUlebPqox91E0tzuJ61geOtRUadJ/vhRWi1xnn3rjfiBqP+jRoOssxwM+1dNHY56pl6o+X/4Co/SvIf2qbjb8L1tV4bUNUs7f6/vg5/RDXrGovh2+teJ/tTXRmm8G6f3uNVmu2A/uwWzg/wDj06V8/m1S2FqyfZ/joenlsb4imvNfhr+hwltHhGz3Y/dOM0VIVSKNc+/tRX5XKSTs2feq3mfj5qgTWojI33Q5JzwMD/OfxrqfgP4bTU9Vs5MfNv8AKPB+UY+tW/Dnwnmv1g8wsUUZZUTDfrx717d8EPhVa+H7Jbz9yqSYbfI6hQOnr6jPHHNf7G06evPI/hHMc0hGi6NJ3bO68EaJDaWEZlRWhtxvYMMK2319v/r19Gfs663H8bv2QjD5i3EksF9pkhHeSKWRV/QIfxr5N+Nv7QOi/Dfw3eQWckl9qs8LRQQW0ZlLuec8dAM9a9D/AOCLfjfX7rwZ410HWtJ1eztIb+LWdPnurNoYWMyCOZFdsZO6NG244+Y5OcD828UHGrlsZRfvU5KVvw/W/wAj3PDfC1oYipWqJqM48uv3nY/8EX/DEN5+1F4u+0Tac89gYSbDUIyqzAiRfkmH+rcEEc7e3JxivtD/AIK4+D/+Es/ZD8YwpcahbMti7NY3FhHeBhtADRzM4BAPPGDgdK+WP2e/Cp+AH/BSnV4YY1Gn+NNMkvbUE4DYy2APVW3jFe7ftmapb+Lvgl4rsprpUur+zktktxOU2IAGLAkYDHop9j0r8dzW9aUMRB6OKf8AX9XPuMGvYydCW6Z+AXg+30/T0VptQ1NbhjtWOG7+wqfr/rT9MDNcr8a9Tm8OW1lcG1hWS6YxbzdXUjvgEmQllRCcn+6a9a8IeGrjS79YY7xt3nF13v5mHV+CBjup7nHBOcc1x/8AwUJ0GTQtQ8JpMRvlt5XLHG4j5eoXjuehJ968nG4hwoScXr/wx9Nh/eqxj0/4DPNfBYk1S8hiSa8WS6ZTxc4Byc8hI1PX/bHWv0k/4JUfsaaD+0Xa/FrwXq9551l4i8GS6SZvICrZTTSJ5E4JLM5SREbJY8KR3r86f2fNEk1PxLD+73oy7VcErt5HOR6DPBr9sP8AgjXoNvbeDfHHiC3DLb3V5a6bal8k7Yoy0g554ZlH1rjqSthH5rX8jol/Hsj8FPE/gvVPhX4+1rwzrlu1rrXhy/n0y/hYcxTwyGN1/wC+lP4V0uh3HmaXIF+UMhGB3P6/5FfX3/BxJ+zo3wp/bjTx7Z2/l6P8UtPivZCq4RNQt0SC4HAwC6rFKe5aRzXxV4bvgsLLublfmxXg4a8W4s9Cp70edHr3wG+C918av2Z/idptipe80e/tNbtwRnc8cEylR6EqSMj1IrxrwnqUkVwi5C7eQGHT2r6C/Yg+Ly/DXw98SLQGVptW0yJ41jUtISjMCQcBEUb9zSSOqqo43MQteD+II408VS3EC/6NeO1xEw+6QWIbHqAwI/GvQrU7Qp1Y9rP72jlo1H7SpCXdNfcv8j1bRJG1nwhIjDLBQ24fw+or9lv+DUj9oGbRPh74o8JTzbbe08RRxyRNztS6h/dsP+2yY+havxb+GF+txA8O1lby8jj05Pf2r9DP+Dc7xQ2g/tSeOtF85o49UsLK+jA4w8N0Bke+JajEq9LU1w/N7SyP1H/4OLP+Cemlfth/scX3iK2ttQk8ZeB45b7SzbBpjOAm54inTBVScjHTk1/Kt4p07ytYyq/M6KHQj5kYccj3GK/s6/4KGfsvWP7Q/wACtXuJLrWINS8P2c17ax219LFBcbELPHJGp2vuUEDIzkjnGa/mv/4Kr+GtJ0/9o3RdeXwvp+hr4i0m2trm509WWHULy2Xy3neLhUmlj8suF+VmRmwCxr5/A1KdbE/U6r5W1eL6Pe68meviMPOnhfrlL3knaS6x7PzT/Dsz4Vi8P3jW7TNE6wqMliMKPxpttpa3EHm+eqxLwZCfl6E9fbFfYHwx/Zg1T4jaTLeafptzJbWSBpfLgkk2rgkMyKDgYB5bA4614X+1L8G2+H3jLTIP9FFrqDPkQRspuHXBz6EAEDp1J/D6OtldKnonzPt/X/DnzuHzSVWXLa39f8A4/wAFeBG8UWC3DNcRrMWMccZG51HAYk8AE+vp3r9LP2QPh9pfww+Fulf8Ibpf2PVNYhhkvJYZZJZrmZVJBMjHcArM+AMBQTxXx98HdJt2srePyY1KgLg4woGcenNffH/BN6LUIZriSRbRoFs5FtjM2V+ZyudoBIG3PJGCRjPNepTo0sJDnpx95Lfv/keLjMTVxNRU5NqLf9ep7D+154tt/g9/wRK/aD0vVo5tU8TeNNOsI4RAgLW6pfQlyzNglVVjIduclT9a/CePRLW7sGZZZhd/Z5LsEr+5ZY2AKeu7Bznpjj3r9lv+Cnvi95f2Y/FWhwbprzUtKvFhhVSoVY7ObOFAG7cZFAA7jNfkj+zD8IdR/aW+MfhP4daHLDHr3jjWbPQdLad3S3WS9mS1LylQzCNN6yMVViEjc4O3FeTiuaclOW8tfLovyPWy+XLTdOG0du+uv5n9D3/Br3/wT18Nfs2fsE6P8dLvw2t38RviQs129/NF5l1ZaOJGjijtVIzGGVfNYD5pQQOflFfbXxT8VjxU1wvnRtBfQ+ZazxtlUDDDpnupIOD2wvpXi/wg/bc1D9kS88M/A34xeEk+F9/o9nb+HfCPiC2cyeGPFMEIENsIbkgLBc/JF+5kILeaB8rER16p40061n1G6uLRfJsr4CZoMY+xzsSJYwP4QWDMB718znXtKTd9vLa3Rp9V+TPoMDOFXX8+/byf5o3PhZ4qh8T+GLmGaBG1GXLXIlAaN541KksvcSKMMO+5vWvkfUNDuvgXLP4Pt5Lq58N+bLcaB5rlmhtWYssRb+JoSTG3f5Q3RhXs/hHxmfDXi6OYNgTSZcf3jja39af4z8Oab4k057HU7X7Zptw7SRMjlJrZ+7RuuCrY7jqK8nFRWIw8Xe0l1/z9T0svrPDV5KSvF2uvTqvNfk2fM+uvdQLY3UMf2ZGdzcFODKoOQAffkfSti28B3vxs1bTNBu7ppJtTleZYVP8Aq7cDMsrAfdijX+I9SVXkkA9Pqv7H2n63eL/xW/jJdOBysT21s8gXjgS4C/iUJ9c16j8Pvhv4d+CHgm503wxZ3EV/rhSO6vruY3F7cqOB5kh7DLEIoCjJIAzXx0MnqOparbfofZ4jiChGlfD/ABW002+/+vzOv8RWVn4b+G0FhpsflW8VgTCP4ti4C/8AjtcxpGmqqQybvnkjXaB1zxj9a6nxnZSNe/Y0jk8mHS5FDFcLhQo/pXFTfE7QPhjp+p+I9fvI4dF8K6XPq+oeWVklWCCF5XKoDlm2qdqj7xIHevpMPRUnY+MqVWl5nYeJP2ffEPi74reDb7wt4sm8IW+qH+yfG5s7RZLzWdLjWe5ht4ZiC1s4md42lXDeVO+GV0jI/LH/AIOxP20fB0UerfCnSvE9j4m8Ya1d2Y1CytEXb4atbYmQxysGbMrybQB8pHzcDAz9FXfxe8WftLWdv8Xvjpc618Cv2b/DVrc3+j+D3vPsvi7xncT20sKXN4In/ckvcxi1tI3Z2k2hvlyzfzj/AB98A+KPhT8avE/h/wAbWXiDTvFWnahINSh12No9S8x/3ge4DEt5jo6uck8tXXSwKmoqf2WpfNdPle782ehTzaVGjKEdXKLjstE2m3fduySW1l9xr+HvgtJN+zdN8RmkcRxeMrXwxAmPlZ2tZLl298BFGP8AaFeTL1r9PP2mP2LfEXwT/wCDe34B+JF0e7ZNc8XXPjnxDcRrk6ZDfwCHTWkHUI8EUbq3IHnjn5q/M3U7f7PqdxH8vySsPl6de1epCVzwelw02CS8u4444zIzHhVGSe/8q2LWH7TcIvUZFXPgY7j4x+Fkjurez+0anBbtPOu6KGORhG7OP7oVjn0r9Pf2QP2J/wBnv/gm/wDB61+LH7YVjp/iLxZ4siM3gz4ZXEjb7Kw81sajfwgqzSzoF8mE5SOM733PKFh6KOk03sTLXRHh/wCwF8AfDfx/+Gmq6H/Z8LeLvDmt2fiGCQ7Ve4sBtimTpuaNSCHQcbp4mz8uK/R3xT4M8YNJot14J1ay03SI2L3Mc1i0mFOflRhKqRqPlyNh4GBgnI/Lf4s/8FRbTw34b+JehfBr4Z+B/hnZ+LPErXukeItO04R69pejbJV/s0SsX2q7NE5dNjrsZSWDjb+nX7KfxS1L4h/sl+B2mvU03XtZsbHUmN3CJIb4+Xh4pBkEbj82VIIba3IG0+NxBFSrutSvaTWj6aJP5dux9ZkOKh7NUaiV4rdaX10v59+57sE8XapqHge80eP/AIlOntJJqtqNMtruTVZ2VxFG7zEGOMcNmP5vlPc5HnX7WXwSHiX9ur4eNcQWK2mmvc+LdXsw28RN5CW8MeCcgNIsbAN1EbHmvpH4dzTaT8LU1jxBfQ+GdB8KIL65NjKdSu7jY4Yqm62i2bhkBULMxIBZVBB/Mv8AZx/4LG/DT9o79qT4meJfFhn+H/iDx3qQGjDVJFOnmyhUrbwNcA4hnwAWVwIyx+VySFr5/JaaeIq4hbwjJJWvfnvH8IuTv5WOriDE8tCNBR1k1d325WpemrSWnc+Yf26dev8AWfivr1nNNeTW+lyLbW0TFmjtlESZVF6KM5P1JNeU/D34QeKrT4anxs3h/VW8Jyzy6aNWFszWqXUWwvCz9FcLLEcNjIcYr0j9sS/uJPjP41k8yXyZNXuVQBztKq5UY9RxxzX6Rf8ABtt4as/2u/8AgnV+0x8ANQa3kn1YnUdPF0f3cM91a+SsxIy2FmtoCcA/dr9lpxVLLqba0UY7eiV/xPyzEKVWvJJ6uT3+Z+KfxUZpzuf73TjuKwPACPHqKtgrvc7fQ4xmvYf2g/glrPw+8a614d1qxm0/WPD97Pp99byJtNtPC7I6Nx1DKR+FcPb+Hf7L8MaRMmPM+2SxEjvlEP8AT9a4KdOXted9CvbJUvZ9z3D4XW22xC+T5jMASdvv617B8LojpetrcO22K1UyPgADbjv0rz/4L6WzaUsjq7AKMYGPr/TqPX0zXe+J5z4S+FXjTVleOOSx8O31xCSTjeIX2j6lto/GvS9panJvojwK0eetGK6tfmfm9Nc/bZpJz1ndpD77jn+tOhwzKPeokTyY1X+4AM/lU8J+cfTNfHR11PupFmwfa4/OursNTms4bOSF3jkQOwZCQfvf/Wrk7eNi/wAvzfSt6GTEVuv3dsPIPu7n+or6HK6j+FnFiIp6noXw/wDECT69Z/bLK3umjLusyEwTAqjNksvDdP41b6iuh8C6NY6pqsP2PUfJaRl/c34EZUnHAkX5GHudn+73PEeAZ9t5NKc/6PazS5H+5t/9mrq/hdCJNes1bp5i5B4719Pg481W6euh42JuoO59M/H/AOGd58LNFtLe5s5YFvYLGUSFcqQY5mJyMggkrj6V71+w5bf2J/wT8+MOoY2trnizQdHU/wB4RLLdN/6CK8u/blnufAniDQLezmlgMtpA7KrfIcWsJOR0wfO7ivZ/gB4kj8Nf8E29JmutL0y7fxN4/u7jy5Ekjjxa2SxB8ROmT+9xySOelcfEXOnCm9eapHb+7723/bvcxymK5Of+6/x0/Xscf4qu/JsjycZ5r7q/YwtDpXwG8BWq/euLQzke8s7n/CvhfxT8VPJs9sOg+F4/lb72mrKQPq5Y1+hX7Pi+bL4Gs/Lhh2Wenho4YxHGCUVyAo4A5PArx88rSWFipK2rf3L/AIJ6GDhF1pWfRfmfXtzc7Cyj+Hj6AVSmuv51DdX2XY/U1RuL3Br80jqfTcpcnu9iM3sT/OuD8Y3Yn1nTIf8AaLdfpXS31/iBvoea4bWrv7R4zt1znyoi38zXfT92FzkqauxY1O68st3rwP8AaCv2v/jD4ftlyf7P0e6ueD90zTxJn8oTXtmoXWR/Ovnv4kakupfH7xE33l07TbCxHP8AERJcN/6OWvk88l/sc13t+aZ7eURviU+yf+X6jWjZgu4K3yjqKKbBdb5G2+wPeivz/kb2Pr+e2j/Mj034BeD7CLy4fDGjqjDBHk5yPetmy+F3h+1jWOPQ9J8uPG0NaoQv6V0MCqOP4uwq3GgOPu8c8dK/sarmeLn8dST9ZN/mz8Mp4WjG3LBL5IpaR4R0uwfzIdL0yJ+AGS0jVvzxW3tZlUEsVXtnge1Mhj2j+9irEbcevpxmvLqSbd2d0drI8v8A2k/DjaRP4X8c26t9q8HXpWZlHzNa3GI26ckK+xvzrz39pr4k6lcfBK38aKI7nTZNQm0omORZPIaNVYtMoOYw24hd+N2zjNfRniLQIfFegXmm3KL9nvoXgkHswxn8OK/NrS/jevw50z4zfDHxtqEGn6TeW7m1a4R3zqdq4eFUK8KZU3LufIG1RwWJr3MsqTrYZ0lq4a/9uvf9X87Hg5lShDEKq/tfmv8AgfkfKfgXWjf6hP5Sxxyw3UsRbHzKfN+UkD0Hf0xxWH/wUm/0648Fz4bfJbTb2dhlvmHOB0rZ8BeKNP1T4lXs2mW6yQykAgHHzZxuOfx6Vlf8FCdRt73xp4ThDR+XDpzTfL3YsP04Fc+Mo8ycDuwdT95F/wBbHHfs/wBoukSeZIywBkA3+ZgEd+elfuR/wTh8Mr4R/Yz8Fybds2tQy6rKQMb/ADZW2H8Y1Q/jX4W/Ci4i1jV9N0lpo7FdWv7ay3sRsiMsqIXI9t2a/og8PeHrTwJ4e0/QtPQQ2Gi2sWn2yf3Y4lEa/oorz8dJKjGPn+X/AA520ov2jmz5a/4Lhfs5t+0R+xFqF3YwJca14HuV1i1bB8zyvuTIvHOVI49q/CXSGaCZo2Vtw4K9Ctf04+O/D8PjzwVq+h3Sedb6xZy2jxkcOHUjH51/Oj+1h8OZvhF8fdY0Wa1+w3FpIMxYOAMfKRx0IAOfr1ryfYpxdXrG33P/AIJ2U6nv+zfVfkef6jdNaWF4u51Vl+cK2NwU5wfUd8e1dV8WLCHwjq+j6TJbx219a2ELXiRtuQM8aNgH1Odxz0JrldVXz9LvD827yXY8f7P+fyrrP2srQ6N+0LrFq3/LtFZgEHPW0iY/zqfrDhCa72X43/Q1dNSlF9r/AOX6ml8PNQKyxNuVcZHLbc/54NfaH/BF/wCKVv4A/wCChOh2803lt4m06806LZho3lWI3EYJJBwTAQCAeSB3zXwN4flaNI5IlJ/56fLuz78e3NeqfCn453nwJ+L/AIL8b2StLL4V1KG88oHYbhFb548jkb1LJnHRjW8nz0+Umk1Ct95/aXrF7DY6dM8yiRfLc+VwTNhSSoHckA8V/Nb/AMFXvC//AAm/wVfxZpVrcWumWOtxz24ZAfILM26LcOPlD4z3Cg+1f0BfC743w/G74V+Fb6z1bTYde8T6G+sWASMyLLEyARzjI2qreZG21ufnwOlfIf7Sfgn4hfs2fCPxl4fb4FXXx1g+IFzbQusFut/ZwrDp0MM08kKDzVd3V9rAKdwzkcZ+cp5fUqY6k9nF9bJbq+r9D36OYUKGArqp7ykrWV77NLS3nc/GD9nH9oXxV4Z8CXWh6X4m1zQ9L1oR/wBo2NlfywxagVUhTIFI3YDMMZxgkc1yn7WfgyPxx8Jn1K3t411Dw6xuI2dOWjB+cevI5r9C/wDgnb/wQZ8VfGzx3/bHxG0HxF8OPBdrBue0uV+zX+pSsuVSNH/eRoMgsXVSPujnOPNP2+P2F7z9j74u33hiSa41Xw1q0Bl068uFVGuYyu2SNlBz8rFk3HhtvBJBr7rE1KPtrU5Jtb2PzejCsoqUotJ3tc/N34LzG20VJo1P74gqo6n/ADmv1r/Zh0LTf2e/g/b3/wDZsuqaxdWEZjt8BXlG3zGIBxwW5PU7UBx2P5i6D8Pf+EM+IEmgssyQafd+Wr7TzESGDY902175qHxCsbDVoNS0PwydO1bTxtsdTF7LeSWoU9gxAjJIzxg9uRXTUw7qx5IvdL+tzmq4qFOp7R+ZU/bt+MOpeLdJ8ba1JdRM66JcizWGQtDGjwkgx5ALDvuwMgE14j/wQc+DehfGD/gpv4Bs/EXjQ/D/AEnQba/1ka6l/HYzWNzDaulq8UsoMYkFxLCwD8NtI6kA2P2rtevPF/gXxPd65Z6dDcf2ZI5k09GjkjO0+WWjHO1nKhjjABOSBzXtX/Btb4L0TSfG/wAZPHnjr4S+Jvij8PbXwvD4X1GLStJGo/ZXubhLl2KHBBEdsDuV1wCOeRXBjKbjiKdNdI30tpbtfTp13PUymovq9Wo3o312/DXr8j9PP2rtc/aI+Cvw41Xwf8Xvhvo/7ZvwJ1R2hn1Dw1tTxIto4BJlss7ZZosB42iLEsqnzEHT5q/ZL+JX7Qfxc8Ra7of7OXx88J+OPCWnWbWdlovxX0i7g13w7HFIAgumWCSV5BhkUvklMAsxXc2zrXh39kTxH4+a+/Z9/ai8Yfs0+Jp2MN14fudRk0/TxKBwpg1AC1OOBhZScqRnrXmvxI+B2p3f7cOnwfGT9sbQdNaPwmJLbxl4Y1ez8OajdQyzbktLuQytC8cgR5EKtn5CQK+WzW7q8lrW7xav58uq+5r0Z9Rl6XslPvbrf8d38/8AgHpfif4L/t4Wl79tufjV8EbW9t5vOW1tvDtx9mZz1Us1uG2/hn2r0PQpf+ChesaR/Zq2v7Ka/YSs41aS41PF0cAcRLCWXPvGor5B+LnwR/YR8N6jL/bP7UnijxFfNJkzp40vdUbf3bfbQyKfrnFdZ8Pvgz+zfqunr/Zv7f3jfTvCkkSt/ZMvxJgszCuB8v7/AGTgD02gjpXlQjek1b/yQ7JNqaf6n0taaJ+30rSed4k/ZT0mK8Jy0Njq1y1qQPvKrW6qzZ7E4rPuf2d/2uPEF+uoeJv2uvBfhHTNPYNePovg2KJYlOcnfLIoBxnBbjgV8o+ONF/4J3eB7yS38RftGePvGDx5ysXiPXNRV2PcPb25jPpw2K+Rf+Ciesfsl6j4V8LR/s36l4k1HVpr2ZvE6ar9v8ma2VF+zsRdAB38wv0BIB7Vph6KnLTR/wCH/Nk1JWR95eNfA37JfiD4o6i3xG/bp+Jni6+FrImou/jsC2vXOR5apYwsmA2DsQk8dwDXndvo37HfhXxJqX/DP/xI1LXPjtpNzaweGbrxPdaxPoUbPdQRXF5dPNCkDw21rJcyDcwHmJHwwyK/L/TNW/smaOWORLX7OrYMahdh2nkY71+kHw4+Ifjy6+F/wZ8OeO/2W/AviDw7cXdi+iLfeI7C3Pi8wWcqW8bMzERsWulmZZiqMyxqeSAdJUfZWg5b6bpInmbXMump9dfBH4wfDWH42Wesf214k/bs/agsbVZdGsvD1iG8IeEZYwTE0cuVsbSMS4L3JeaQdcrwR+fn/Bwb+xl8RvAv7Yfgfxd8RvEnhnXviR8d7WK41nSvDyIsOgXayR28dpEGYPLGI2jVZnwJChOSPmP6p/DfVv2pbv4fw+HtL8I/Bn9j/wADzL89z/adtq+qnP3ngtrc/Z/MA5UnBBA4Ir5D/bv0PwHo37WHwP8A2efBmh6542+KHjzx7ovjPWfiz44vPKk1PyZnDQQttLJGQrFxtULhAEb5cY4ipTpYj2bkuZra6bt120SXZFUo1J0HVUXZddbH0x+3f+0t4Y+K/wCzB4u+EvhTRLzSbFdJjsdMlV4pLe2trHZ5cRg2/NH5MO0oOi9MkCv5rbmf7XcySf8APRy2B2yc1/RB8Wf+CfXj3wd4R8R6xrPjD4U2NjZaJqD3Tw+ILm4m8s2kwzHi1C7ySuAzAZ6kda/ngsbOa+kght4ZLi4mKxxRRqXeRzgKoA5JJIAA7mqozg1aD2MKXNy+8e+/sIfHnT/2TtR8T/EC+8P+H/Ft8liNJ0HR9ZszcWlzfNIkouXGQDHbCNXZQfmaSJSMOTXnnxt+NPir9on4oav408b65f8AiTxRrkxmvdQvJPMkkPYDsqKMAKMAAAYr9L/DH/BM/wCDvi/4B+GfB95pV5Y+KtN0+Jb/AF+x1RzK1+yKblkVz5TJ524AbeUROeBj4M/bZ/Yu8TfsL/FODw/4lkhvtP1e0/tHQ9WhQrDqtsWKEheSkiOpR4zyCARlGVjx4XOsNiarw1OWqv8APu1/Vz2MXk+Jw1JVqi0lb5ev9WPFJRuDx4yvX+X+NfrB/wAEjv22PDPxA+DWg+BPEl5HY+JvBm2zgEw+S+tVP7t1P94A7SOvy55zX5Pw/vPmP3i1afg6bVrbxBbyaJ/aP9p7S8X2FHecADLEBASQAMnjHFdGMwvt6fJez7nNgsV7CpztXXU/ox/4KH/tt6H+zL+xbruqX01srX1mbLR7FZAH1K5cYRVGckA/MxH3VUnoK/nDjgbytshDtyWz3J6/1rsfjTrfjnxBqmnXfjqbxRcXTRNDZPrKSJtRDh1jDAAYONwAyDjPauSJ2J/OuXK8sjhIvW8nv8jbMMw+sNKKtFbfPr+R6L4D+ImpL4Ju9JvJnurO3TzLPf8AM8GPvKGPOzBHB6V+kP8Awa5ftkaD+y7+0Z8ZdY8T3PlaLY/De71y5RXAmlSxlSZliDEK0jBtoBIyWUZ5r8vfhxfGw8RLK4DQ22GkVhlSucMD9ea+yvi5+w58SPh/+zb4s8dab4O8dWPhOHSit5qsGj3EdhNZSSJndOUEbwsQp4Yg4BzXvQzf2ajhaqbjLT5aHjywfNerHdanUf8ABSj9sTwr+3x+1B4g+KHg7wpqnhSx8SW1u99Z3k0U5lnjj8ozgxqoXfGsW5fn+cOdx3cfNniTw+8fw8jlVG8q11GKQEfwh1Kc+gJ2gevPpVn4IQ2974FikudYsrdlQg+ZsZ3wOgXlifYKT7Veh8TWNj8I/EFrcTSNP4g1e2tbIznbJIYCJnPPQ8xjb1G7kA5A9yhXjGCb2ul97S9T5+UJVK1o76v7k2/yPWPgyvkeGYt3zSYGASQRjrz+NXP2qL86Z+x34+uEbabqGzslYfLnzbyDcB9UDfga0vgZ4Ykl8LxyMke7YDkxvJjPqF68Y7+lY/7YzS6r+yp4ytI1dY9PisrsmRlVpNl5BkBc9AjOx7/KBzzXTiYWo1LdjzcPJPF029rn5/Py351LEOPwrS0Xw7Jeo0jQv5JHysRjd9KtT+B7qOPdCDJ32EYb8PWvjo1oJ2bPunCT1Mu3ysild27PGO1dFBfqDHHJGtwAiBm+7JnaM4PsfXI9qwPs8lpcNHIrxyLnIYYIrStgftDYx1xivey+SWpyVoneeC7C3ubfUmtbpVdbJl8u5xEwLMo4f7h/EqfbvXpXwZ8HST+IYVkSWGSOQZDrtI5z/n/CvJvCsvk6XqLHqyRp16ZkB/lXtXgHX/8AhC4tFberRXdkt2isPlTMjoQPTlD0r6jC+1V3B3tb9P6/U8PGW+F9T6N/awvP+FseMNLvMD/RrFIsAcYWOOLP/kKvZLDQRF+zB+z54RjZlbWr/VLx9nUi4vLeAH64jfH0r5W8RfEm31BrNvPazka0VsyZePJeQ8kAsvX0I+lfTni/V9W8IaT8C72xm0Fbjwx4UtLxRqOrWltEZnubi4yRLKhZTuU5AwcV5Gb16tTEU76O8mvlGSX/AKUa4GmoU5drRX4r/I92/a+/Y1+FfwT+F/juTSx4gvte0Czia1nurstCJJruG2TOMAtmUcYwea+hPglbLD8WNKtx92wAix6eVDt/mor4V1/9qHxh+0D4o03wz4g8WfD9bHxJrVgb6206KWW5vWiuY5I1MkMLofmRcbpAOOuK+2P2ctY/tf4o3VwedqTy/wDfRx/7NXyWKpYyjheTGT5pe8929GopbpdU9j2aMqNSrzUVbZdN/l6n0hdaiMdTVO41Hms241HCH/OKoz6ng8k9a+YjuerI0tR1D/R2+auKOqLL4zvW3cwwhcfUAf1rVv8AUSy471wltrIXUdTlz96XYOPf/wCtXoS0os4XrL5m/qOrdv71fNFzrv8AafxG8ZXmS32nWnhX3WFEiH/oFey6n4pS1cNIzLGp3OQMhQOSc/Tmvl/4eeKP7a0Q6gG41C6uLzJ/25WYZ/A18bxDK2HjHz/R/wCZ9JkdO9WUvL9f+AeoaPdq6yHLZJySp60Vzul6gXtcnnnjr/Sivj+VH0nLHqzsLn9qH4c6M2LjxpoasDjakrSH/wAdU1l3X7c/wt08/wDIzef2zFZTMOP+Aivzxt4vtKr5ME0gx1SJmJq3aeEdYvJF+z6Lqk3GMrZyfzxX9cSw0Vvc/A1jJbJH3tJ/wUQ+GsBxFeatdcf8s7IjP5kVRuP+ClXgmFsQafr0ze8SR/1r4y0v4OeMb8q0PhXXZAw4Y2xGf++q6LTf2b/iFOh8vwxqCrIMZkZEyPxNYSp01u/xNvrNVvRH01c/8FOdDhYCHwprE7Acf6TGN36GvzX/AOCi/wAS5fil8XPFGsW1q+k2t5cx3BErF2R2jHyKBjJ7ljgdq+oLL9kP4iXRC/2PDDgcGS7Xj+dfC/7WlxM/jnWoLiaKH7NOYHXORuQBeD06g17OR06a9rKH8tt/M5sRKpUnTUu99uxyf7PviuPSPFunxLM237YHdmARSAc5JySPyra/bR8TW+r/ABH01Yo1maKIhtrkh+h44Gc9vrXnfwe0efxJ4x8mF5PMtYWu1jiiMpuAhXK8fdGCTuPAxzVjxr4nkvfiI11qhmuWj3phmGcbiOpPbqOcZx2rzlLno870/wCHR6sqdsQmuzY34ceIZtP+L/hSbdCvk6xZXSH74jKzoygj6gcV+oHiP9uj4r6heSZ8Rx2pYkkQWcS9/dTX5Yvqtn4j+LPh+4glmWK6vLJJQ2C8GJUTr3OBmv3Cm/4Ja+G4tRlWfVPEl3tkPWdFzyevy15c8RTS959XbS/Y0xFOp7vJp3PmPU/2s/idqCHzPGmsKcf8s5Ej7cfdUV8//wDBTj4aSeIb/wAC+MI90jeI9Et5pZmkzmQLscevLIx9Oe1fpPYf8Ezvh/Gnz2OqXZU/8tNQbn64rkv28f2R9Nj/AGVtJtdN09o4fCjSwwLkyNFG7NKvzHJ4Z3Az24oo4ijUUqK6+XY5uSpTlGbez79z8ffCnwql1+6axEcm68t3iA29CVYfzxXE/FGwvIPGlx9vt5ra6kKwiN1wXKIqYX+9yOoyK+1vAHw/SxvLfbHu2DIY/Ngd/wCVcv8A8FTfH+vL+2Fa+ENDtIdDs9D0WwjsHsVNqx+1wxyzTu0ZH33dRluFVAO+a87FRStTXV/5/wCZ6uFlKc7f10PC/hr8Nru60i2uLi1uLVdSeSEwzQmPYVwUYBwD83zD6iumvvgrcXui3Ea7pPLQsFaTA6dj716J+xb47utWbxL8D/GFzYrextDf+FXYB/8AiZW8rNNB5ozlpoHlxk/M8SAcnn6db9nOGDS7W5nUbbiHLxqTjnggjpwSa7cK4Sp7baHPmNOrh67g9/ys9vVNWKX7Dv7V3xKjvNN1O41HxLc6dNpkui31zGZDDZKoiz8y4CHEEIz6dK/WT/gl3+334h+I/wAf18M+L/El9q1trlm1ppSXjDME0WZAucDczJvGTz8g54r8VPip8QX/AGXv2aviFoVr9uhbXr7TbjTI7aEyebcxXCysjkEFY2ESkkZJ2lcYY11PgL9pLUtM1fw1qOg6pJa6lpV7DeWUqDd9nmjZZIpfQrkAkHggkHgmvYwmFp4qlUw81qtnbut/kzwcbjKmHq08TC/K91ft/wAOf1QV+e//AAWp/YRtfiB4fk+K2iGO01fS7YQatH5VxcNqKqQIPLihVj5uTt3NhAvLHjNfWn7Ev7SH/DW37Lfg/wAftZf2dda5aMLy2U5jhuopGhnCHvH5sb7SeSuM85r1Q9K+KjKpha7i94tpr80fXVKdPE0U1s7NP8mfy4+OPhlLpXxUttQvrSa3uIbeQXdtPE0UmIhuBIbBVgGxgjPSuL1b4n694gg/scW9rJb7mY3FqnlXEagfKM9D1H1r75/4Le6FH4a/bG8XXVroN1pMepafFcfvJFP9oyPEY5bpFBJVWwq4OCTGzY+avzs8Z6iui6XFY26xxtFFufsSx5JJ/ACvv8oftKXNJdvyPzvNvcr8kXvc89+IHh/XvHngzxhoPh/TNQ1vVXsA8cFnAWuFVXXz3YD+FYd5cngLkniv2m/4NgfgPr37JX/BPLxrqGqSSWuseJ/FstzJbllkjtxBawxYUglWBI5YdcY7V+H+kftLX37NNhrmtafZw32q+ItPutMV5j8trFIYxNJ2JJBCD/eOa/pM/YI0e68Af8EwPhXHqarFqmqeGbfWL0Z6TXa+f/6C6fyr4/jDETWKaTVuVLre+/ofecK4WmsKrp8zl8raL9GeW/tOeJ/C/wAfPHkln8QPhv8AD3xxuYQ/aNR0lPtYTOB++A8wY9m4r4H8V+EvhFP8F/A/xNi/ZW16Pw9ptzqWkXng200SSSLXdGe/lm0zX7UTYkvF2uI2dWY/vM/cIr6i/aO8fN4C0bxb4otbebULrQdPubuztIUMkt9crG32e3RRyzyzeXGqgZLSADk12jfsbah8GP2FfCfwrbxdfX3ibwDptloUviV3bUrf4d6va6Yl25nU4LWMwnlhK/dECwBSGiQn5bhGWIxn1j2sm9lH13f6ff3sfT8VU8Pg40PZRs95W7bbfefJen/tI+G9U0/yfhn/AME6/F95Y7Qou9R8H2emwuuOzTW7E/i1ZcnxM8Dy6it54w/4Jt+Nl1CHiWfSvC1tfQs3/bKJVxx1wa9Z0DwH+318UrGTT5/GfwR8HxW/7sXVjoFzqFyQMgELJ5g5GD0xjGKpeGfgB+2p4T1k2f8Aw0H8M9TljxM32vwSN7Z/hYRxqQD61vSmotxbX3yPOnG6TRX8HftI/FS4tIW+DP7B9v4Gt7f9y2oeKm0/w40fU5VfLjmZef4d3Jrwf/gqL+zV+2L/AMFCfCPhS+174a+DRH4AkvJoNO8PeIvtd9cm5SBXfE5VW2iAYVW3HccAnAr6Q1z9mP8Aa08cRyQ+Nv2pvCngnQ4ome5/4RnwzDY3Wz+958wUovJ53jHFeA/EbwZ8DvhRdsvi/wDb8+L2qauz+Q7ad46mlaNARujKWolUA/7w+hxRTkoVfdt9zf4lSXNA+GfgJ/wSh+Ofxr8WTW+qeBfEXw78N6XII9b8SeLtPk0nTtHjbPJafZ5rnAASPOSy5Kr81euftRafc/BHxX4Z0Hw78brn416b4TtgweS8t5rPQXDqot4zGzICyxR7gWOAEHavQPE0n7D/AIh1xW1LxZ8c/jZJaSEW8N9farqltdOVI+XbFExK5HRl7ZyOK8W8dW8WtalqnjDwb4BbwH8M7XxA/ha1smtzHLpt5BBHKY7jDFkllRjJh8ljHIMkoaeIlKUry29NP8/+AEdI6bn7G/BPXNP+I3wU0XWNNjt/L1GxjuUMYXgMASCR12nI+ornde/Yrvf2q/2z/wBm3xZpC2y6t8NfFzXeoPKwXOneRJKxHrtmijGByfNz2ry7/glP8WW8RfDK48O3UyyT6TIZYMZ5gkOQMf7LZ/OvqXwP8U7r4Z/EOHUtPjYXWlzLOrbcoexVv9lhlT7Gvhswj7DEQxcfsvX06/hc+wwMvrOGnh31Wnr0/E+hP2sf+CbWrftA/s0+PPB+n+JrXTNW8SaNNY2dx9nOxZDghXOc7H27GIGQGJAOMV/Ib8FdHXRP2ifDdjdmOb7BrKxMYm3JJJExClT3BZQQe/Ff1BftS/8ABWDxR4T/AGe/Hmr2+seH9BksPDuoy2d3Ja/uY7n7NKINxLMT++2DAGSeK/lJtZ5LV4ZI3kjmh2sjqxV0YYIII5BBGcjpX2FD2dSm1R2fX16nyP8ACmlNap6r03R+0/hmWyvtLh32m3egY+YMsD9PWtzXvg3oPxk8Cy+F9e0uPVvDdxdRXz6bOX+zGeJJUjmCAgLIizzKHGGAmcZwxr5au/jtpXwB/wCCP3gPxJr9v4o8QfGz4vajqw8N65LqNxb22jabY3ZtJJmQKI7mRJIyAGLZM3zHCba8L+Dv7Y3xsuoGNn8TvEkcMUioUcQONxz2aI8YFfJx4WrRblCSXndr8lofZS4soOHLUi38kfW3jD/gij8MvFTmfR/+Eg8Psx4W1vPOiX6LICR+derfsMf8E4bf9kvwn8VNHtGHjJfiRpdlZW51iwt5ItHktbo3Cz+W6skjDPynAKkZBr5p8Z/t3/tGfDn4bRa/o/ifTtYWx2i6tr3Q7WTzkwzb0ZFVtwCkle4xjng/an/BPP8Aar+IH7Qv7LHh3xJ4kj8P3ni7xB4ln0+LTtJRIll08W6tFLgSPtZpScsSBgYxkV1xw+ZU0v3t163/ADRwVcxyqqv4Vn5K35NG5+1b8Jrj9rv/AIJ7/ED4c+Mm06fxpb7dU8KXepmZ0sby3jt8zQyRxyOjTRRTRGNVzJuVMElSPwN8Y+Dtc+H+oR2uvaHrWg3bkssOp2MtpISMZAEignGRnFf0VfFz9oLwz8H5PAdj4quobq+8eWzzwRafbENpgSSOFjch2HlAzzRQq5+VpJVXjOa67/gpV+zx8K/E/wDwTU8e+HfHmo2+jw3WnxX2m6zdAySafrIdF07yVUFvnuJo4XVescsucAbl66ea16NRRrxvzP59vmcayzDVablh2/zX+aR/NNozC3s7rLZ8yIxsB2VuDz6mv0j+Nv8AwV4+N/7Z37DniDw/4m+IGqapps+jjTdVs0jhgW5eFY2Yy7EDN5iqshySCWPuK8X+Af8AwQv+Pfxymthb2/hHR7CZlZ7u91bcqA452IrM2PSuu8H/ALNGn/BbQde8G3Ekeoaqbm707VbyIN5dzKjSW+UVvuqu3jgHHJ9vQqZjh5STpTu4tPTt5nnVMDiKcb1ItJ9/Q+R/APiC4hs/JheURsMlBIQp4xyBzxX0T8GJv7Q+Ds2mqR5P2+QzoANpYogBx0GNuPbA718uaLaS6XqU9nMu2a1leCRTkEMjFWH5ivp79kbTX1rwprMaN81vPD0IwAyt0H/Aa+jzVf8ACZNrpyv/AMmR4GESjjYvo7/kz6u/ZL8F2Pi/4U3cqz28E1qDbzRuxSQMuQecEeh/GuT8Q+E7OHVdS0rUrNHsbyGW1LNGzBopUMcm0yAZba55HvXJ6N4s1v8AZ817/hINNmm+w3Bjt9WhLfKykkRy9RgrkqTnowz0rprnXbfxnf8A263babghi2V5Oe2Bnt3Jr2spxixuHVZ/a0a7Pqv1Xkz5zNcK8JX5Y9Hdel9/8z5s8W/s7Xng/XLrT7pB51m+A4U4nT+CQexBB/GsaX4SvB832eRRkAkjG6vsfxt4QbxP4f066ijaS/ssWs2wbmkiYEp+KkEfRh2BqOx/Yz+IGvaX9uh8D+I2tGXeLmeza3g29c732qOPfHGa/O8wpTweIlRe3TzXQ+6wOLjiKEau19/XqfGl98HI9Tg8uW3WRe2Ru/I9Qa5PXv2fbu2LTac7OSf9TJ/Fn0b/ABFfezfsc67p9r9p1K68G6Pbt1N14osJJCOn+qhlkkH025rk2+HumaZctHI0d8IzjzImJRyB1BIGR74rTB5jVpS5oO3qaVKUZLU+HbHSbrRbSa2vIZLW4eaMbZBjcAGbg9COnIJFe5ftJfs/eMP2Z7f4YWXjHT/7JuvEvgq38S6fasf30djc3l4YjKvO12KM2OoVlyAcgfSvgrw/8P4LuNfF/gGXxVpSn95bDVDbGQDtuCMRnocYPPUV0/8AwWklu/2xf2o/+Ek02zs9Nl0/w3pek2lmLlpoIrZIDMsaNjjD3Eh5HU+tfouSZ/ReHnKtaOyb3V+mm6vZ90reZ87jMHN1Y8nm7f16+up8L69qMwu4ICzbltbZMemYk/qa+tP2stQNp8RdP0/tovh7S7EDsNlohP6sa+Wr/wAM6hF8W7Gxv7Oaxe91GCKNZBhZF3qoKnoeB2r6J/aZ8b6VdfHTxc0nmTNHqDwKwIGVjwi/otbVq0amLoyhqlCT+9w/yZn7Nxoy/wAS/C5H+ytrtnP+1L4G+2T29rb2t3LdtJM4VB5NtLKuSePvIBk+tfqB+yAXl1nUpmVt0dogBx13N/8AWr8Ptc8RLN4hxFJG6skiEZyArAqf0bH4mvqb9iT4geJNG8Aalb6b4m8RadaSTIFgtNQliUAA8AKRgZPQYFeLxXaXwv7KX4v/ADOzK/cSv3bP2RuYbrymk+z3Gzu2w4/PFcb4g+LXhvw1Iy6h4i0KyaM4ZZtQiRl+o3Zr83/EFpeauWuNQutQvpGXHmXt1LcNjvzIxNef67qUWkzMFVRg/wAIAr42hhesj2J4jpE/X74F6x4Z/aE17WLXR/E2l3Ueh2kl1dvG52rtBwAzAK2TxkEivILfxGs0E8kbblmmLBh0bGe/418X/Bb9sWfwV8APEnw+09R5/wAQNQtYby5DjAt0kAZMdcn1+vrX0zp2sr/Ydu0aqBhsFRxjcQP5V2ZhTjToJRe5x4acp1PeRpfELxf/AGL4S1a63lTb2U0gIPcI2P6V4L4Ev1tvDdjD/wA84EB+pAJ4rqP2hfGC2vwm17DrvmtvJQZ5YuVH9a8+03U1jtI1X/lmuwZ7cAV+f8RLSC9X+R9hkqSUpPyPQYNUkFsm2T5uS3P5UVzMeq7Y1Cn+EZ4HBor5N4WMtW19x9DFqx9MWnwptrCMCG1toOvCQoucfhWxp/wyViDlY8DAIABHvXeWf2dDgorY6Ejp9KvRXMKH5Y1+Xk8f5zX9QM/C47nFQ/DOJRuz5m3geh9OKsRfDhVf5YQMdABXZxarHE/KoPTgfNU0etx5Zl2jaOWIxgVi1Y1jc5G5+H/k2crR28bFY3Yk8DIUmv5uf2k/Ec138RddLPIskmoTsfm2/wDLRutf09R64sy+X95ZBg4GMg1/MR+2joUnhP8AaK8ZaZIuxrHWbuIjbjH71sfpXrZbiHSw1dLdpfqKNPmxEL9L/oL+y54x0vwBrupa1qDPPdJCtlb2wkEe8SEs0hc8gL5WDj+/zxXD/FC6bUdcuLxo2hW+lkuVVm3YDuzdcc1h2rAn+lTeKLm4naFZm8yO3VVjGeAvXGPzrmliksI015Hf7Fe25yDwvqUel+KNLuJGO23vYJWwMthZVY4HU8Cv6r/AvxA8K/HTwbbeKPCetWesaHq5Z7a4hBAPzHIKkAqwPVSARX8sfg/x5L4UtrgQfu5pj96JVVv++sZxkZwODX7x/wDBDLW7XXP+Cc/he+t4JLee41PUvtoL7leZLhlyvHClAhx67vavKpOMqXL21++y/QrFRfxH2O2i20KkByWB444P4V4b+0H4g1u3/aD8G+CdQ0on4e/EbRbzTxfhSYhqfmfuWBPyhkMQTnnEzdjXsmZR0XHoc/5zWXr9l4imsGtdJ8T6hpVrJOJXt0ZdpkyPnUOCFY4wSACfWt8NONKopNbfqrfqcco80XGXX8D8y9c+FsngX4mX+j3cLRm2lZSrLjIyfavn/wDa4+BOp/HH43RNqkNvcXDLDaR6jCxjuLW23IqF8AmRY13DGfu9uK+tP+CiP7Wnww0L4v3urabdX32m0LRajDJYSo8Uqthvkx83zA4IOKP+CaXx+8N/tZ+KvGUTeGYrW58NQWlza6hKSJ7uKVpFYPHkqm1lXBByQ3PQVhjrSnHka3v8j0Mv9rRi6k46W9Oq+9HzH8Y/+CVnib9lXSdO8fap4/8AhnHNoMsF9pmpWniC0jtXeORDB5Uat5pOcEqU3fezX25oj6X8Z/hpp3iTRWt7zS9Wg+2QG1JaABid6qSASFcMvI6AV9JQ+BfD+u7Wn8P6LJcRr/rmtIyT9cjFauveBbVPDQaCG3UWqEFEURr5ZOD90cAHB4967KOMlOpyzSs/z8+5w4qMOS8VZp99Ldknr+LPjTwD4Cx8fPDL2mpXWg3txPJbw6haJGZ7VzE5DJvVgG425xkBj6nPxz+0z4B1T4Eftg+MPCtlczX19c36XGlTXHlo12t5h1dgoVMmR2B2hR8vSvvr4n6V/wAK98U2moTRtG2kXcd6EjjYFgjByOctyAeprz39tz9l7TviD+138MfHlta4j/tbSZb+XyldJbWKcT7yrAj/AFabT1GSAR6+xlNXkxsVLaSt+KseLjoc+Fl5a/gfuZ+yh8IfD/7LnwQ8IfDHw611/Z/hTTFswbomSe4lHzzTySYCs8krSSNtAXLnAUYUd9rNhbeK7C5s9Qsy2n8b/NfasvPTgg445zwc18rfsI/tfzftIftHeNNHWTWJtP8AD9j9rWa4a3jt2eWbhI40USbUQhd7n5tucUn/AAV614/DX9kzV/iBoHgTS/iZ4g064gS303WZL+7sreN2CPMtnA4L7QBlU2FupbjnwcVgJxx3sajfM7Nta6vXuj0sDmDngPbaW10bt7q07S/L7j49/wCDhv42/D3w/wCHbXwv4D0HwLeeMLeCP+3dZggT7RodrHNGYbZHQhFeQNNuByVQAYG8Y/Gjxr4stbrQLq/juvNmumI252hByOfzAGPSvSPiX4q8TftjfFS7tbi38K6BfQW8l3NoOi6RNpGm2yQruZpYcmRSTtXLksWYY5Ncla/sreKvih8VdN8C6L4ZuLXV5rOSeOK41qJLFET5nmZ2gDmMDkqBvy2N2TX1GDrUMBSdKpP3t9Xrr/wx41bC1sbVVeENPLbTV9EeL6l8N7r4wfF/4f8AgezT7Re+K9S0/SYhHiQl7u7RVXgnDHeuQefkAr+qj9pWeP4a/DFdF0tQljotmmn24HAWKGMRJjHoqCvxd+EX/BMO9+Df7ffwG8YeF5NBuNH8J+MtC1jXb7Ubp1vbgQXcLzBE+5gYIQ/eIVScHOf3Q+OvgaHxN4Vuv3fmcMBx7GvzXiiq67lOm9z9E4ZUKaipLZn5g/E7wb4y+Ogk8OeA7z7P4usbS48cWZTJnnGiyW93HHAq8tK121mVAzkI47ivtrxl8erC08EeF/2q/CsbX3w78X6Za2fxP0i2B8y0SJtqahHGuC11aTZjctlmiVQDhRXwl8d/2K2+OH7QvhC2s9UtbHxF4Vvp7jw9Z6tFcSaTrFxNsxaXa28sMzRsyIAqyKjNw+5SVb9Kv2T/AADb/AP4HatoXxA+GPg34c6T4kaU61ZWOpwzeGdVMy7ZXS3lYJaiRTtaEKEKgDkAY24NqUIZWrayU3zLq72un8lFpq9mk/Rcae1eZa6RcFyu11ps/vbTXbTtf8uv23f2Pf2avh34+uNQ8b/E/wCN3wT8HeKppbzR9D0vxPJb+DbpS5YT6OVt5ofskyFZo4VYGJZAoVFUKvy74t8Kf8E2/CjeTYeKfiV4lvfMxJcQ6lf3MrLgZ5jijXaDz93ufbH2l8efikfgD4G8UfBLwv8AEf8AZX+Jnwl0+9k1Dw1pfjjUpp9S8L2nneYsSzhZ4JgjEqrFd6gsc/MQPkrxV/wXN1L9n2VtE0/4S/BjXLi3j8sXvhnXvOs5l6ABIbVWHTkEjtXZm1FxxDlSu09d7fPVX9d9b6s8/LqzlRSqbr1f9f5GF4R8OfsI31359t8M/jb41s1YBZza61PDK2c+SQjpntx9K9v8Hftb/B74PxKfhD+xFrX220URRapqnhWy0lgehH2q8Elx2GTu5z614R4c/wCC83i7x3cfY/EC6L4F0ra0ssfhfwdNqd9GoGTtkv71YVb38lwMdDXVaP8A8FAv2Z/EmoSaprXxh/aTs9Uuwpka7sLeRRjtGkcDLChIyUj2qTzgnmvHrc+0ot/N/wDAPRpyj0aPaPBv7ZXx6+LnxVi8P6cv7OPwla2Xzp9JvtWudc1iBCV3HyLd1UEKwbBTBOM8HFfI/wASLdPiDFqngvw342vFtNBvtT8XeIrHVrr+ybDVNalvWLJFE2BPepbtHGplA4jdY8Anf9a/CP8A4KU/s06HbNb6R8TvifJdHLLqFxpupJdZPowXbxxxtwPpxXkH7SOv/s+/tEReNPET/EL4weKviRcWcUvhubWdIhWxa4hkDeROYrSJ5BLHviWSbcYyUbJCkEw9Gu5aU3byTIqVqSWs196PT/8Agi5otx478YeJltfs82p6fo0k8FmUJub8xTwtJFbjvIIt7bTyQpxxnH6VeFfA9jqtj9qt1ik+2Qhg6gHcpGQf1r5C/wCDeb9o74RfsgeFvHDfETXLXwz4i1y9t/sM99bSFfsyI4IVwpC/MzZ6dfTFe1fBD9uDwHp/7YPir4RSePrPxlcXF5cazomux2f2OzvRd3E1w2mQsXcSvaq6oHBHmKBhQVNcuMyubguaLTXc7cBjoq/JJNeTPmX/AIKl/seah8S/hhqmh6XdXlvFNcG+jtY2Cw3cwVlMb8cbgx2nOA4U1+T/AOwr/wAEofi5/wAFD/i7q3hfwDpdvb2fhzf/AG3rusl7PTdBC7+Ll9pKyHy5MIBk7G7A1/Tv8YfgpY/EnwtMqRrKzLkYxk/Q/wBK+KdT1iH9gL9nb9qa60rxBpPw78Q+MtLi1G5v7uxnuG1uSOKS1EcIjmj+zzuJgTKoc7iXIODnzcrq1cLW+p1fgfwvs+3z/P1PZx1GljKP1mn8a+LzXf5fl6H4iftM+NdV1T4NfB/wvdeK5ta0XwLpWq6fpWlvEqLo5l1e6nmkVlUF1uGZXBcl1EYX7qqaufsrXflarHDD5JuHUuBIflc9l69+lVvjZ4Hjn+CPw78QW9rCv2yymhmnjIIl/etLGGx6b5APTBH0j/Zo0Rrn7Rf2kNnJqGjXMUyrMuUuI2yGRvQcZz2Jr6aoly2R8fUlc9/1L4o6f/wlXiHRm0ydvCqaM15aXKkBEmIXzLVcg/vFlUOvR1Af+ErXypB8UfF/wC8b30/gXxX4i8K299Mt7GNKv3tlbdgqSqHbkEEZxnAK9OK+g/2mPEMV38P5NT021mE0t0IGSS3HmQziEA/MOXMcckqqwxlbsA52jHyrr+narZvZzX1ndRW85kSEzxMokAbeVBI5wTnjpms6cUwhJ3PZPhr+3PHp2s3eofFDwvrPxnku9KvdNktNe8TXEen4klS4tYlgjAMVtFdItw8UTKJHiiA2KHEnAfB39pfxx8P/AAs3giDxZ4ij8B61f21zqvh83TS6beyxyB45Ggc7NyyBHyMHdGjclFxxtxbqD8v4H1rV+GXhmTxr8SPD+ixxlpNR1CGHjrjcC2fooJqalOmoNzWm/wBx2Yec+dKD1bt95/Qp+wX8Ro20S1sVmHnKq8HOScepr4q/aJ/4kH7RvxAt4Y+F8Sai4UAKF33Mj/8As1fXP7C/gMyX9vIzNGkYBJJ4X3NeN/E79rj4Y3njnW9R0f4A+FNW1K71CeafV/EniXVNRGov5jZmFrC9vHGj43CPLBQ2MnHP5/lb5q9Rx0Vl/Wlz7TiGKjRpxlv/AMA/J39pLTl8LftDeJXaFrWPUL03yK6lVbzgJHK5HzDezcjI7V71/wAE+bLWPGM3iDTdF0XUtWaSOOZxbWMty6nO1AAqnqC/JHbjvXqP7en7X3hfxBpGl/2x4J8D+FtQmEyaZp/hDSjp1vbJGsZWV4maQESMZVaQtvLIpJbJx5d+zv8Atj/Eb4S/FLw7H4T1pvDtv8RETRr86Pd32n3bW8G6ba0iSIJMG45OCpwBjvX6FicZGpl7o31cV33Wr/I+Cp4ZrEKo1on+D0/U+mvEP7M3j46Bdx6r4J8RaXY3ETJK+paY9ioVlILZnVM4z2zXzr8C/Gd14c8SXmhahIyzafK1syt0BDYB9817jqmtah4lv2uNSvtR1G5Zvnnu7l5pM/7zk5/+tXz58fYpPAvxvstYEJhs9UhjZptmEkkQbX5P8WNpx75rPg3GcmIlheklf5r/AIH5GXEmD9pQ9ot4/k/+CfU2jf6d4T1RF2kSWhkTJ5DIyscenGawl0dLrc0isxxgFzuI/Os34SfE6z1fTbW2haS+nmdbVkjVnYrJ8pUY4LEHCqOWYqAM100Vi0D+W+WeN/mU/eUg8jNacY0uXEQn3Vvuf/BObheT9hOPnf71/wAAqQ6HtbdHCu1ucgDI9MVN/wAI9uVm2jdgdVH+RWlZWyyBRnDKeOTj+daEFqwjGC3y8cV8pGNtj6N36mNZaACFUj+Llev5/wCfStPUdK/te9Mk8jSNhVy/PCgAD6AYFaMdthAWjZinIwNpz/8Aqqzb2LMR+73hjkgjocVvCo4x5VsxcivdnNxfD3Tdf1O2FxbxSNDOk0LmMNtdWBVgTkbgRkZpdZ+DWk6hq9xdyaTpcl1cytLLPJZxSNKxOSxLKeTk13PhvR1/tKM+Wqc7jtJXp/MVrQ2TRpIF4WQ9MDcevfGef6VMKlROydtupcqcbbHj2sfAbTPE1i1nfWy3FqcYQDCrjBGMdPw9K9Z/Zd/4J8XkehTTWnjLR/A/h+aUSvc6zrEET9cfJGpMzY64CVqaT4WjngkbtkDHOB3NdBpPw+V7ZZMKuTnITLUSrSjpd29Q9in0O4uP2ev2f/h9ZBfFXxP+IPxMvlGTZeH1Nrauw7edNxt/4CK8s+LnhT4b+LtQgTwf8N7DwfY2oO6SbVbnU7y9P96RpG8tfoiDnvXWW/w8WQ4Zj2+6MVLD8OIYzn5tvcgYOfWiWKnJcq0X9dwjRijxC5/Z80Y6lZ6glhb29xHKHSSJBH8ynIzjANd2b/WLaxghiFqfs6bAxB9znHrzivTNb8F2sXgrT9vzSRXDDAHVT6nrWLN4ZyP3a8eg7Y461nVrSS5blQpxbvY8c+JWka54r0E2U9xDDHJKjgwx8gqwYdScjI5B5PqK5uBda8PRKt5a/aow4JmtCc490PI/Amvb9a8PeYY90ZHJ/wA//XrLk8KLg/KfUn+6PavIxkY1naqehhpSpx90880jxnZ6irPHdRhlAV0J2Mh5+8DyD9aK6zVPhZY6vMJLrTbK8dflDSQqxX8xRXlf2VQevN/X3r8j0o5lJKzj+J92luDyFXHJAxkVLHJJMWz8qnjkVDtOcK3mK2eOuKsxFisat1XpgHgetf0BofkKQHTJCMs/CkDIHXvU1tCF25YMzE8kU6ORooP9Z5gGCBnqMVMG835hnauOeuP8azk+hrEr3Dw6HYzXlzIsVtZxtNLIeBGq/MxPYAAZ+lfz2/8ABV/w/H4p/bD8ZeKfCtjqepeE9euhfWd+llIsU+9FLMOOm7OCcZr+gzxxZTX/AIB1y1s7ZL68urCZLe3llEMdw5QhY2fB2hmIGcHGa/n/AP2pf2ifEnw08U6n4Z1rwxq3hPxBprfZr3T7i5VmtpFIOMrw8eCNpHUbT7V0UJRVOpzPdfgOKl7SLgfLNj4X1a8vUt4dL1KSaU7FjFs+5jkDHT1P61vfEd9euNQjh8TW1naahb28MOIoo0fylQRpu2cMwVRknkkc81Z/4XbqUybpp9RuZVkLgtcYzk5OevXv3969i8d/C3Q/D37Cngjx3qiQX3jD4na7fiCWN2UadYWcaxC3K5AZmkbfnnGB1rjw7jUfInp5/wBf16noVLx1aPmIqI5GX04r91P+DcfxDP4j/YCvrGYhotB8W3sEKls7Vkjilx6j5mY++a/DPVXikv3MKuI+g3/eyBz+tfc//BCv/gof4f8A2KvjP4g8O+OtSm03wT48SFfthTdb6bqEZIjmlxykbIzIXAIGQTwMjjoWVSUF10X3r/I0rxcqf4n7sSReWfQNyDjNZ9/I3lfMGPO76e9a+n6xZ+IdLhvbWa2vrOdd8M9vIJI5B2KsvBrP1CZWhk/d/KoI+Tk4rTrqcNz8n/8AgtN+zHC+vXHiSG4ttPXUEa5IRP8AXNuYuCMHcwOG4x976VxP/Bv74ri0n46+MtFuLhZH1Tw4zRKUIM7QXMTZ68FUdz7g+1eqf8FRPjZY+OPHmreHU2mPQ4jYoAWYO5++eBgYJx3zj2FfJP7IE+r/AA6+NM9xolxJY3n9nzwLLEdkjIWj3qM4wMbc/wD6682tUVOsmj6WjRcsHee7X/DH7g6JfrDcNGzRxrMMENwfX+laOr3dneaBe2AvfLW+ge3MkUo81Sw4Kkg/MDgjI6gdOtfnf4S+J/ii41OKS61S4mY8ESSlvwr1bSvFuszMirLJu+hranjLyTSPIlg1azZ5n+0n/wAFEPhn8N9KvBo/h3xt4reHMVvqF2YrSG52qARsdnddrZU5AJxnB78r+yp+2ff/ALTPwdm8Q+ItUt08RNrE2kadpYnVPs1tDApgRTgBgRIQWCjJQk+3gP7RXhS48c654ot5v9Ht/wC0rkRsgys6NKSCoBAVg2d3I6V4lqvxXm8H+Ir64+x6bBbyJDG9hd2vm2+9I8KYghQx9xuUgkYr6jhnFRqY32tdrlir289PyPP4kyvkwXssMneel7v+tVfZH7tf8EV/HOmfDn47/Fa71abS7a9tPDdnNfzNfqn2XdKQ0bMeEBEatznrXKf8F0f+C3euaT4WsPAH7O/jOSz1hXeXxTq3h9HurizgCgpFFd7DHFzkuyHfjABXnP5yf8E4vi7ouqfDn4jND4b0/RF1u6tNK1iWTUGay1BXDyICs8m5SCpz94AEZOOBxP7S3xN8YfDLw1efDO58ReH7fwpqZeezvoypkW0MpJizEfnCsGXn5sD0Ix9VmGXUMRP+0rJp7du2qf6nxGX1K2GqfUE2nHuvRu1r/cnex3//AASw1fWvjH41+Lq31zLql9qdlY6vqepXJa71K8MMs7FN7cvvzvKsw3GJDzivqzVbeP4RfFHw3rkMz3lvcRFNOnCqjXcVyEjlL5yY9g52DksgGQAa+Mv+CQPxpt/hf8b/ABLpFpaLq1nfWKXf24ExPB5DOuT8rjayy4CE5yfrn3v4zfF7VL7UI9M82D+zV1VLyFI4hiNi+WkiGA0fTcy/dPzcDdmvis2jFzcu/wDwx9vhajSUei/X+v0PZPF/xGksrh2WcBtxIOeVIIOR9DX6bfsHftGW/wC1V8AoWupI/wC3NPUWV+A2cyqo2tj0dcH65r8VPFPjC5h0tnmmJnRi+SMkDHXtntXvf/BL39qK++CXxv0+81KZ4fDetkabqgVNwgQ8pd4H/PJ8Zx1V3FfKU8LVxM/ZU43dm/ktz2I4qlh1zzlZNr7+n9fM+zf24PgvPb3ya3psb2+o6XIsyNHlWyp3BlI+6QQCD6gV+Vf7W/7UXjLxH8cdc0vxZFP4iuEkD295qt7cXvmxOAUYJI+1cZwVXABU4HSv6BfiP4Hj8d+HFeRoZDJHkSIQ0dwpGQwI6gjkEV+V/wDwVB/Yd/tLT18SaBYP/bGnhpJ4Fj3NeQA7mCdiyjJA74NePluKq5TjJThK0Klk/J9H+j/4B9BmmFhm2AVKUbzp3a81bVfqvPTqfk98WtahCyN/Zuh2sb8KyWe3I67QpyB75rxSfxPC99JDHaW0fzHaUm+zkH8Ux+tdz8atfn8Qzx5laFSOdgBLDPJwfX/61eSXE0mArxrIvT/6/wD9avvKmYYhq8pfkfC4fB0Yq0UaRklEsivJNDNJkYYHdhupBzg/1zUOj2kFt8yrGzJgStL9xc9MsATzg8cdOtZZuJ4byNVkMixglckqvTPGef0FVDduU+XdHuGWAf7/AHBP41wrFWnzNXPQ9jePKmes6XrFrpcUe+8j8uThZJVMMI/65xrmSQ9ssQMdjXt3wn8cAahbp5c3I/1tyPL3Y6bY+W54+ZwAPevkvw5qbWV8rwzLDM33p5FzIo6YVuQPrgGvePg74yt9PsPLuLaZ9zb0kQ+Y7nIy0jZOevGd3PGOuPqMtr06610/r+v+CfN5phZU46a/1/X/AAD6++Hev2OrssF4sazd+crLk+v8OOORgcGvRIPhXpetiOezjETRETRSKcS27DoyMMEEdmFfNPgP4iWcs9vJHNtdlDKQo2kHAAA75/2c+/t9HfBj4l28MCyXH7wHkxiPbs+mcfl0r0p4OLWx4dLFThLlZ9Wfss/t4+NfgGLbR/HBvfGnhNcIuobN2raWnQZP/L0i9w2JQB96TpXunxz+Gdp+30dvg2bwndaNoemJqN5qN5am6TUBMxCwGMYYqNh3KSpUnnsD86fDLTNJ8XwBpWcxOOJF9fcf0/WvsP8A4Jhfs/f8I18S/E2sWczx6NNpgtZLcHMTPJIrA4P8X7s8/hXxXEGQ0ZUnUj7rX9fefdcO5/VVZQlr5/5/I/I//gpP+w74V+E/wV128js7rwbrVxfRm20mztWutDvplRvMMUqqotJGHzCORFVxkBmZcn4f/YigisfiNqVnfKpW6tDGI2GR1HPT3P5V/Ud/wUD/AGCPDPxu+C+sW66ZJJb3kLR6nHGTJI0ePlnjBPEkTAMMYyMiv5n/AIofCjU/2LP21tQ8P+JFt430u6VXdATHdWcqAxXMZPO11YMOODkdRXymCr1nzYbE6zWqfdd16dfwPpMww9KUVicMvdejXVP/AIK2/E9KvLLxf4V1/wAN6P4Ts/Cc2oeIda/szTl1KxTUbq6v7u4jihitoHJX5I1DySyIyhdgXnivrz/gqB/wQe/4Y2/ZJ1n4ueJ/jxqHxGtLe80+31DTdQ0YQLctdTw2kb2PlzOsckcswlwiANGjpwpzXhP/AASJ1rw7qn/BRqx1TxLrWkw3nhrTL7VfCDXMySDUL23t5mhtUBK7ZGklEykkktAFCnO5fqr4vWfiL9sX/gnx4n+D+reIYbFVv7TWfDniC+vYvsOmXls5zDdW8LyTCKaGSQfukbyplRihVmK+hh5OMnGo/dueXKnBxTtqz8K/GPhVvCPirU9HmZJvsr74JI23JPGRlXU9wQQfevUP+CeHgpvF/wC1ZpDGPeuk2lzekD+9s8tT/wCRDXn/AMafh7rvwr8YTaBrUSrfeHXNqsqOJEmjzuRlYcMhDHB9PpX2r/wRA/Z7k8X6x4i8aTRYhuJF0qzyOoT55SP+BFR+Fc2a1I08JN36W+89LJKLq4uC7O7+R+jNx4jb4EfsbeK9eXFrfT2g0+0c/wAM05EQOfYMW/4DX593MX2FismI9uVHO4nB6g//AFq+nv8AgtZ8aYfhj8M/hv8ADXT3T+0teun1q9jzgpbQrsiyP9qRmPvsr5j1LW7G/wDAFvrswl3yWvmmFcbmkUYbb0HJwcnjn2r5vK8C44X23WTf3dP1PWz7Ge1xfsl0X49fwseB/tp65pNp4UtLG3t7WTXNS1NLjasIMlvEkUwZhISXVXkuAPLAKFkY8ELXe/szeGbW08Naffz2NpHdWrtFbSrAweFWRVcAyElAxCk7cA4zivFPEugXXxF8cSa1qaqsgb92odkSKMdgeecc5IIz25r0DwL491bUvHek+EPDumyyaXpdxFPqt+U+RQo3CIH7owNoJBJLZHFenim5wVNPzbPPoRcU5y6n0zptv9oA3KGYnkfe/H0/TvXn37Rc2k+GTod1qWiN4iUXC2I09iFhUXcsaJNI5BC4kj2gEZYFyMbOe80S9NuVb+6TuBb7mfw/D8K87/as0u18WeAfFH3lvrGLSZ7UDLK0yz3LEFVZc/u3JwScdcdDXPgOalXjUhun+en5MxrctSm4TWjPfPAHxp8Pfsq/Dxb7wl8P/h/DrUbja2o63PasJT8qeSFtZpHcsVAVdhOeCK4j4N+MPFXxBttZbxp4btfCvijTNTkhvbO1k8y1YyAShkyzFOHA2MSR+OB5R+yBaT+N/FmgSaeskk+kTG+u5LixSRbKZvlhlQzSeY3lLvcAlgJDGQnykV9M+EPAWi+D1vLfSrNrNLi/nubr5mY3Exlbc5J5J2hRxjoOmK7czxE6suWo7vv/AF/XoZYXD06SvTVhI9GkX+Hc3THrx/nmp7G0aV1GVXnJOcZH9K1V0yNpQWLYU43ZP+NaFlofmy/KqllOFY45rzLJaHX5mdDass/zKjcAfLwO2P8A9datnpRx5nsAO+fxrRtNAwv7vaMHgYzn/AVp22iM9uoZVV+/B6dv5VpCJLfYzfD+nqLlsxsrKpBO3mtKPRGmTKjHHIGSAK3ND8OsN0m4svTFdPpnhyKK1XvzyR1z6Y9qzlF7lcyOW8P6K06Mdpxu7cf5x/8AWruNI0VobVfvbu3tU2k6GkoGwBiTnhflNddZ6P5MSgqF7Dj+tE43CM+xzqaMiLllyO/PNSDRfkztbOO/aumTRiE+7xj880/+x8Q8qd2P4u9T7MfN1OQvrBZYNuxjg7uD1rNu9Gy+cNxyQPl4rvLjRdycKvy8nP8AQVDNoqn+H5fXpWNWLuOMzzXUdLUz7drDjB7Z9DUY0DCYZdysevcnP+fX+ddxfeH1nmbcrZGBwuOM0xNHZX+4fm5xz0/lmvNqRd9DupyVrHD/APCOKDt2ldowcLnNFd2mkCNm28ZPOVJorn0/ps2T02PWoixb7rDsf4c1JAxZWYg9BlS3f86xTqihVXbM3YhRnJqQ3uyZUVpCQNxHp61+5H5jubYDIq7erc49eOozT1nEGct8jYyA+dntWTBqDAlnOFY8E9RTv7VDfKi/L0+vvUuJV9TVvbyLJUTZOMkIp4r8OP8Agv8A+Fmg/bFbXc2gh1rT40AhU+Yz2/7pjLn+M/KeOxWv2qn1fajbWj645PXPpX5j/wDBxL+z/pU/hfwf8TLS0l/teS9fQ9Vmhb5Hj8rzIGdf72Vdd3cD2FTZ2a7o2pySmmfk7b/dINeqfEbx6/xA/Zw+HGj/AG64VvB76hZ/Z5InMKmWUSoVZc/MwzxgABeteVwqAzKM+2a/Wr/gj1+yr4X+If7Bl3qHinwzpuvw+INeuZlF5AJFRYgI1weqn73TB5rnwlrNPsd2KlyxUl3PybuLhmm2XUaSOvy7onCsf0INWxpUVrZLcXFpq0MM4PlytAGif1w2QD+tft9P/wAEyvgfczNJ/wAK70GNuQVETHH61zvxA/4JF/C34j2KQw2uqeH1Vdpj0u8MKHHqhBDdO4zVxhC7c36aX+853itFZH5PfBT9r7x5+zddibwL4y8VaCV24ihvGFswByAYSWQjOeMDNfr1/wAE1P8Ago746/a3+AV9qnjnT7O11bStQNhFqlnbGCDWUCBi4jztDoTtYp8pOOAcivJtJ/4IC/DVbzzbjXPGV5HnJhN0i7ueRkID/wDqr61/Zn/Yh8MfA3wgmj6RbXkOkQtmCN5T8hOSx/EnJrB1ar91/Iv2lKW6Z+eX7Y3wX+L5+P2uah4X8Mt4q03WJmngntxEzR5ydsitKmCpJ5wRyOe1a/7C/wCwB8RbPxreeLvHFn9huri3eC1tPOV2iDFWd3KkqM7cAAnrzjiv0y1r4b6ZpFwWhtYQFwxJxuPX17VHYWNnbBisbYUfKR6/T8q45UObfc3ePny8qeh5H4a/Z+t9HC77OBpOCWf5sn/CvTLL4eW6WUbbbdcYLALyeavPLZpICvzKGAcbsg/h2rcstUtXg27d3GPu9P6VcaFjlliLvU/Lv46/AfxZ8M/iLqX2vQtU1HRdVvpgl7YKbq3TfIzKZkHzxr2L4IUn0r43/advtP1L4l6ha26TK1mkVvLGnVZYwckdRj5gMe1fuH8SbSxm1C4jkjWSMuH27eCOuAfU+lfhz+194Q1zwB+1F45OtaTqWm2up61eXNm/2Z1iubSSZmhlibG11MZXkE4OQcEEV6uWcsakp2tpYdTEVKtNU5vZ3Xf0Ow/ZS+L/AId8KfAnxp4J8QWtrCurXkWqwX09j9pkimiULGnliRWKFQ/zc7WboQTjzn4+/EDwvd3qL4Wng1Ca4XbdyHRBYxxbCNoQPlmydx4xxjPpXDeG9NGo39xbi+i3NGZEc5+YjseMjOfwrJ1/S7ixu9kioueVZWDK4zjII+h/KvcxubV/qEYU1ZbX32/LQ86jltD65Ks2+Z62/r+tD6f/AOCa37UviH4PyeN/D/hv4f6P441zxgtpNb3N/qBsxpsVmtyXSMBSG3/aNxGR/qh1r3uyl+MfxN16GbxFovhPwro6uDNDYzfabq4GQfL3k4RTgZxyQMcV8N/Aj9oTWvgt8UbTxDYnT5po7eSzMFzbhrZI5MbsIuNp+UfMOfrX3V8Bv20dO/aJTVNNa2t9J1rRUjnnEcga3uY3OzfGx+b5XwCG7upBOTj4+VSpOneo/wAf+GbPVnHlm+RHoup+El2mS4lgm3DoeAv+elejfCDQI7jV44bZVjWErZxlh8oY/ebpk9T14rzC71WR9Hmks2tp9QtwTDDNIVRj1BYjJ2g8nA7GvavgBpMln4USaf7Obu8jLy7T8qk46E5OCSK+s4Yw8VQq4pf4V+b++6Pk8/rt16eH/wC3v0X6/efdH/BNn46+Kn+M9v8AD+4dtY8I3FheXhaQb30YRKMFW7RMzBdpzgsuO9ek/tOadDcaX9qt41KrdKkYUcoRk151/wAErVtT4v8AiBFEsa3yaJbrE458qNZm8wD0z8v1xXqXxD8Fa54l8FPdW+n3lxbWss9058o4+T5jz/u5r8842jF1ZU1Hdf0/xP0ngqT9lCpKXXqfzpf8FSPgGnwi/bF8Yafp9vHY6ZqUq6xp0Y4ijhuVVyowPlVZfNUdhtr5aXQW1SdorSC4vZl+8kcJkYgcbmAHH9O/Nftt/wAFO/2cPh/r2p+GfiH450LxprVrpsT6PLY+G4kae/WQebD5hZ0xGvzYIPO6vjHwTZ2lt4g1ew8C/CTWPh/od9bus2patextqF5g/JEVWR9q5JP3scVOW5oqmX03a8kuV+q0u/Xf5mGbYFUcfUje0W+ZfPU/PvV9G1TTbY3kljc2dqHEH2iaMpHuIPy7iMZIU4HfB9KyftUcS4aSFvcODX6Laz+x9N8Vf2Yvi14Zjkt7jxVDY2/inRIt+7zHsZWa5jB/vNbSzNgdfK9Tivzy8XfDjUfCRiW5tpBHIokjcD5ZFIODXo03KVONS2/4anJHk5nFPb/IgWeOVciSH8HFbXg/xw/hi/V0uWj7BklxiuRjtW2N8uAPXipI7Fi6rt5zxyOa6KOInTlzQIqUozjyy2Ppf4XftD6OdYhbVJLCRgnl+Y5EZQZBG0qQRjsBivqb4T61a65NDc2d9utmjVYgHVo+Bj5pQcMScctjHUk9D+aVtochI8xVXPI8whQfxPFei/BPxjrnw/1OOXSLy6tirAmOOUNG5yOqk4/LmvrctzadRqFVfNf5Hy+ZZLT5eelLXs/8z9b/AAJ47bw7qXlxt9n2naVSR2SUqeQDtA3+w6jpnqf18/4JV6xY+I/2cp9RtRm4uNRdZyeSdqLtGfxP51/Ot8OPihrGu6FDLqWsQwQW8YEd9d+ZJDZoFLHMcIJeUEHjBwMHgZr9W/8Ag3//AOCgGj65qMnw8muNUu7TXn3WOsX8P2ZdQv0U+ZHBF/c2g5KjaCoBOTisuIed0bdn/X9M34djDnlfe1vnv+X/AAx+oXxU+I9l8MfAN5rl/uENttCw/wDLSd2IAjUd2bOAO5r8nf8AgsD+yz8KviH478IeIZNAt9W1UzXsVpJKfJ8vT0EMhgl+YEqlxJKFDcAb+QTX6TftKfGjwz8ObgTarq2lR6ro1o9/penzyDfPcuGSOUrg/Knzc9c5PGAT+Rf7QfxpvPiz8e7eNtK1a303SIBaaXFfpDHNcRZLSXgVZHbbI7MR5gjfaq5UDBb8zqKpUxaqL4YJ/e1b8b7f3U+p+hR9nTwjpv4p2+699vK2/m10Pmnw/wD8E8dP/a2/av0lfC/hrXhp/hrShdXaeFbYmIOs4FsjiIMVU7pd0hwSIgN2a+3vCH/BM3xJpcu7xN410f4T6LJ+8uJdd1y086NPVYd7NuHo7R4AOSK+Q9X1jxL8NPinL/Zs2rafp+rRpYXrW121vFPMjtJ5TrG4LHa4Zdy7SCSrEhgvpEfwW8R6z8H9b8XXyrp+n6a4R7i5DLJIxAOORk/U8ciiLc9G3955tZKMrozf+Ck//BL/APZj1j4G3S+Afj5/wkfxYtbq3jgSGIX1pqlu0wFxHvhRlWVY3lkR2l27k2HAbcvqn7A/wN0P4LeCdJ0ezWHTNJ0dMEzvxGhy0ksj926szH3r43+CniDTdM8Z3Wvaxq0N9fSXv2LStNWQNI3BLyMuflULli54AGMksAdn/goB/wAFHdF+Ev7ON94K8OXbSeNvFmntZP5Egb7BbyjZNO5Byu6PesY6ktu6DnycZz4mpDDUvhX9X9D6bLYww2FlianxP77dPmz5E/a5/a+m/bI/a48UePLia4/sXUrk2ehRMPmtdLhZltlC/wALMv7xhwd0jA9K6TxjZ6x8Rv2adUj0CO6uNW0q8W6t4rc7mlibCypjgEY5x6g18x+GZEVk8kNGuVBHb0GPpX2D+zx4otfD+nsskVxNDfPBZqkS7m3SsqBsDsOp9Bz0r66UIwo8kVsj4+pVcq6nLds8K8DeFfiZ4nktdPTwtqNrIrbRPeWzW0CepYvgH1wCfoa+uPhf4Bl8F6DZ2cxa6uoYlWedUwJJMEM2MDv/ADFeiWvhdCFbafT1H+Fa9p4eUBtq/M2OMdf8ivk60vbNXSVux7MajUbbnl/iHxdskaGw0m+vrpRlHMRt7ZfdpG5wO4RXPT1Fclq3ga8+IGmtpt9N/rrz7bfXKKQ00uwxoiL/AAoikBcn+EcHmvavEvhuSK0kmEPMYJ3AZPHY4/rXy98Ev2yP+EU1q5s/EGnNczJeS7zbygPGu/j5JMbu33T0rqwtGTu4a2MKkorVn0z+yl4El8Bw31vNcXNxdX2RmZcNMcBVYj7jhVVQGGG5II7npPhP4j/4TKDVrrdHJDb6pcQxSqSVlCthm+m4Efh3rk/D/wC01p/ipY9P8I6PrF9rGpMYLbzoVjitywwZHKsx2p949OnUV678D/guvww8BabpYRXjtw3yYLYLuXOSM5OSazrNp6lRkrXRdstC+ZZJFVcDBU84P9c+tallpDMEO3hiM5Gcd/rW7b6S2FXy2kzxzxg+w71bttJaTay+X8wySQe39azsrhr1M+y8P75vlVn2/wB35TW5baQLiBQEIPVSU55/H2q7p+iNIyrCytuGCwbI44/xrpNL8IT306hYXaRvlG0cZ68D161pGVloTuY+j6F5NsV2s7dOF4H6/T6Vp2Wl5kKlWLKfu56H1/KuibwLeaLF5Fxby27H5gsism4HnOCB70620baFGMkdgfvGphJT1QSi4kmh6Atx5e1MbTnjOB/n/Cuy0zwPcThSsZZuoyp5/H3pvh3SmyuVB8v5jtPrxX2H+x3oOmTeEryZre2lvo5gh3oGeNcZHXoDzXVQw/tJcrM5VLLQ+V7D4W6hdy4gsbybnpHCzZ/HFasP7PPiy+i/c+G9akVsYIs3UEfUivv5I1iXCqqj0AxTsV6Cy+HVsy9tI/Pu7/Zw8W2c2bnQ7m1H8PnssY/U0sP7NurTEmeWwt8no0hfj/gK/wBa++tT0i31i3aK5hSVGGPmHSvPPGPwSbLTaa29TkmJuo+lP+z6PW5nKtUWx8lwfsupv3XWr5JxnybfHf3NX7f9nLQrUZlmv7k9DmQKOeewr17V9Dm06UxzQvC6nBVlrLmtcdvzp/2fh1ryIj6zU/mOEX4KeG4kC/2b5nu8rMf50V2Tw4bp27miqjh6SVlFfciPbVP5n958kv4gJQAr+7xuz6H2NT2WsNlTIGXop3Z/zzXNMszhSHV5ME4XGP8AOKc921vJ5uFbngDhsf8A1ulfWxkeDbU6hNazKRz8oz6sf/r1JJrnljBkKhRuwO9cva3UwZmWNfmPG5jgc9zTUvbqUllVDxn/AGef1/8Ar1rFpiabOg/4StRKu1tqtySBkk/5/Svi3/guR4tZ/wBmjwzpsUL3VrqmvmSeXJIiaKBmjB+pZsZ9K+prrNo25j8rAZy3XrivhH/gtR8T4tG8M+A9HkLeVfXd3cyMi/d2JEqt74LMPxNVTaU02CjJ6I/MLU9ONtffLEUVj3HvX7I/8EjviHpvgj/gnz4Z02a4mNzJd3l0UWP/AFYeU4/PFfkfrmv6S02Iy827lgi8t3PXpxX39/wSt8UXXi/9mm8t2hNvDp2sTxW8eCQkTBXVQTycE9T3NeZiKipuThqepTg6kVzXPvqx+K+m3XzKsvDcfL1rc8L+L7XWLxU2+XHwAH49zXiHh+wuEdQFyF6gD7vfmu98IRzQanGGXMi/Lx2Hp+PWvKeKm3Y0dCCPbLTWbWEKVVZAeMnnPHtWkdYjK/K0ceB93p/nNcfo9tNGm3cu1hkfKMitYadMybWH+DVr7WTRPs4oz/GWtK6qse3zHIw2cY4PFcwdWEUn7yRB94Dnr7f59Ku+J9MW4vGUq0m0Hbn1rP8A7M8ht0kbbfujjsASKylUqX0M+VEK30ILKvrkqCG79a3ND1IFFVt0cnOeOcjnvWbJYI8iMehyVI6KccVpaTa+QWUq+5QQQT1wfyNONSoyeVHFeLnml1KWZR8rHbnJwK+ffih+zrqHiNrxdF8eeIvDtvcO8xt0ijuoYHc5YxiRSVBOTt5AJr6r1bSPNThRjcAO+PxP1rk9Z8LmVJGMK8ZwQc5JrWE5bPYxnFH5b/tkfsvXnwP8N22u6x8QNY15ptRjtrWG4sIIozI7fPlkUYPllmx3wetfIniS1aS9mXUjM13GxVF2hY9nYrjqD1r9s/jH4S1LUPCWoWdno+g+IrG5i2X2j63GWstRT03YJRxyVYDI7EGvgX41/sD6lrGiahq/w40LWLKaxLSah4G1CdL2SGIdZ9On5NzCOdyNiVR/ewa+iy2VF0Pq8n1v0t0/4fy19Dn53CfO/Tt+P9fI+I3Eck7bSqqtfQn7AOmpL4m1SGDU9Nt7y7iUG3uJBHPcIh3YQHl1BOSF5GMnpXNJ8J7iWHy5LXQbWaNtrskD7kI6jGcZBBHI61ma34e0vwbD51/cy3V3Awkt47ceXtYHIYv1XHtiscRkvLFynKyOmOYRn7sFqfd1zoNxN4Q1b7FNFc6mLOV7SFJQqzyINwXce5xj2yOtfSPw48Q2ei/ChZWmUzRxIgJOWOABnA45ODxxzXwD+yt8ctQ+IvgqRr/a1/Y3Rt0nPWRQAysTj7y5xnuRX1lF8RdP8T/CqN7eSOHWrVfKlthxkgYDbe6k45HTkV1cO5lSp4apg5aNPmXnok/mrf1Y8bOsvqSxMMTHVWs/LW/3an2P/wAEuP2jx8KNc+LvjnUFg/svwv4cg81JHwrySSuwU57bI2J9AK/Taf8AaE0251O1026jXT5ZPB7+J7yyul2tBCwUbJB/DtJYH6Yr+ff4A/FKD4ceG/E+k+Mprez8HeLtS0qfUZpyI45Ft5D5lk7nok0ZdP8AgTZwORtftf8A/Bfq41j40/Fa+0PRdS1jWNY0V/DU6RutrY6dBHIQ0bSSYYfvFYnAyccZzXxWdVcVWxTdKN7pemid9fWyP0LI6OChgo+1kk1e/dN2srfe7+h9J/Hb4pw/E39k27vI4ZYrdtUin05Z+Ge1LHaMHpww47V8wR6XJPMzPbsuRn5QcD6+xryr9nj/AIKJ6l+1Lquh6Fq2kR6DGouJIUt7rfbyFcLEFB+b5QJMs3ViccACvZ7/AFt9NXG/b8o6DqMe3GK87JcDUoUOWe93p22/4cXEuMp18Yp09uVa9/l5bEXhvSJvCWrwapayTLcwncDgDepBDRn2ZSyke9fm1+0X4hbw34517QCvmHQ7x7W2DLw8IYshHsUZT9MV96+K/ilb6XL5s155LMPus3LA8gY9wM8V8Gftv2UQ+NVjqUL7rHXNEtby3kJz5yo0tuSfcNCV5/u170alSnFpbHh0EpTtL+v6uecfCf4X3Hxe+I2jeGbK4isJ9bvo7KNpo3kWBn3YYhR9wbTk54H44+h4v+CP/jx5B/xVXg8LnGQZ2J+g289K8P8Agt4muvh98RPD+sJpqzR6TfLqb753h/dxhgxIVsAAN94jk4XuQf0C8H/tIW+r6Ra3NvdtLb3calHQfeVuMH0PX8q4K+KcNbnf7GV1ZaHnvwq/4IpWd7A9x4i+Il4Y4jh4NJ05UJ55+eRj+gr1Wz/4Ji/CHRNIaz8nxF9pRcjU31IrKTjuFGwDv04rv/A3xWmutBuGg3Bt25ST1J4rNuviDdXlzuaSTbyOuRn244/z1rgnmk4xupfd/wAA0jg+Z2aOJj/Yd8O+DZAtj4w8RiKIl445/Kl8onrgkcH34rsvht4JsPhpqcN9a3uoX17b/wCouZpSs0ByfusPu+uR0qOfV5Li6LswVl/i4bIHb/PvVi0u1m25lLMrbiANv45xn0onxHi5pRdR/gEcpw8XzqCud38Tv2h/Fvj/AEZbW61TUJlgthZwSXVw9xIsK9ItzMWWPPJVcZzXiXw8/br8K/DrxDNpPiDXofBGsIw+12es6exiJz96GdVKvGcZyCM9wDmvR7WPNwzLG0n8bDByPT+Z+lZvib4f6X41tUXUtPs7z5mAS4thKFbjOM9OMfWuf69NXc9U/wCvM6Pq8fs6G94x+OfgX4+6l4Z1Dwz4q8O+KdR0qePz4dIVj9niUN80rYCg5ZQFJJO48AA17/8Atz/E/wD4WT+z3YrpPl29vq2oq17bRqFGUiCqdo/3a+b/AAf4S03wfZfZrGxtbNWO+SOGMRq3PoPoPzrrLrUGi0xbeSNvLRg646A84/Hmoo4pxUl3/ryCpR5pRfY+PPHX7MeseLr6a4huGhkk3AlSyk5ByARzjGRjvXnXjb/gntrmtxtdWd611eEAOZwSXIHHzcnoPw6V9/2FhHIqusasobGR29efqK1V0FYzuVVXdko2PlHHA+nX61jHGVY/DI1lRi1sfl3pH7FPjzSb6Fbjw3dTRhuJraddp+tfVH7K37OOv+BpBdX0MxmmTbHG4DeUOx4GB165r6s07wnHJBH+5VpDhMfeyOvINbFn4XNuF2xrGuPmVfmGTwcj8a6qmY1qkeWWxhHCwjK5yFj4JnJRWCRN0GP6V0en+CYlUb2ZhwAQoweMfzrfsrIwL8wYKuQpHRcdj24z6VpxMrPlhlWTgAY3Ac/jXI1c09Tnm8HafIjK0Z3E7QpXG7qOa4/UP2evCeuXrPeaDpN427DlrZGPrnp7f5xXrNrFHJu+X5vvbAeVyMcf49qo3VhDLd8blGcAMeDj0/nS5ewadTB8G/DXSfAtkDpWl2WnRPtCpbwrGHHbJXr2/Ku0sdIVY49i7WVc7WPzDHJ49qqWOmSSXu3Abg7kwPmGMHiut0uCVIY12/dA2hvbmkotBzGLFpzHdu2d1PPCjt+J4/Op9N0RvLVo1JJ4Of4frXTxaM10uY13MoAwP8KlTQdgIVW7jGNvA/Sqs0TcufCT4f8A/CY+NtJ0tf8AR31C5jtxI4wI9xxk/wA8V+kvws/Zk8IfCW3tWsdMhuNQtwD9uuF3zM394dl9sdK/Onwkh03U7W6XzENrKsoYE4Uhs5Ffph4p8c2PhK98PPqEkUMGpTfZkmfOFkaMlR+JGOa78LUhBPnS6fi7GzwlSpGPs7tvm0W+iTJPiP8ACfQfivpP2TXNPhulUfu5cbZYT/st1H06H0r5j+KH7E194EuJrzSkfWNM3b/3a/6RB/vKOoA7j34FfYFFejWwkKj5tn3OGFaUVbofC/hTwFc6hdLDbWlxNIP4Ioy7Z+gFex/Cz4O+MNGvYrq3jOllerTSbC31Xk49iK+gobeO3DeXGke45O1cZNPqaWE5dWyZTuVtIS6j0+Nb1oZLgD52iBCn8DVmiiuwzCijOKCcCgDN8Q+E7HxNbtHdQqxYYDgfMPxrzHxl8F7rSQ81nm6txyR/EtewZ5oIyKCZRTPmG709reYqy7GHUHg0V9Daz4C0vXbgS3Fqhk9RxmiloZ+zZ+TERjWRdvyMuDgDHSpbaBXb+9tx0xyCMj6VF5eZMxxmPgLhuQx/PpV+BvLKnGN3YqPxyK9WNU8rlGwojv5f+sZjyGfIT047Vdj06MIqbWVccEHO6pbKwLxcQx7iOSucnH41at7CRV+7u6fX/I/Otoy7CsZOoeH82uxY+/AGM9OQf0r5X/4KFfsMX37VXgezh08wrrGls7WbSjdGNwG5eOccDp0r7HtLYgN5jAqOnXLfj69atrYwhJJJFbaq4CVNSpJLQpU0fiT4c/4Io/FzU9eW31m803StN3fPLGxlYr/soMD86+/v2ZP2NYf2ffh1b6Bp0M0kEIBlll4M0p+8ze7H8q+npoo0uNyr5anrkYGPbtSINu8hT83A9jXkTvJ2kzsVSSicBpHw0j08K0nzsgwAeR05rptC0KNbtflVmyDluoOe/atG8ihVhubzAvDZOeT61f0Xa7KrJtwAhIIOP6flSglHQiTb0NzTtOQQjd86j5+n3v8APT8KsXZIRhGqrtUn7vc9c1Pp6R+VHGzh8Dgnj8SOnNLqaBbaQDcVVSSCT8/Pv1ro5tCDi7wh7hS0SDocMe/0/wA9ajh0mOebO0nbyrkk49vcdatahC4K7hvkk+YMOFHtjPH+fSrGj2yCRtwwzDPAyCfT/PvWcpBYzhpCrI+IlXkjO71/+tVmBZII8RseuAwHzcdh/wDWq/f2awLJIoQqRkgD73+eKgHlyP8AMFVudvGMA0Rkuo5RsVLi186F9y/LszkHsKybzR4mimuMHGMgk8E//XroZ42eM7vljwMAH5jjr7VTurTai7yu3OQeeuTjNVzakcp5v4j0nyZmbarLhSPl2spwO/8AWuJ8Z/CzT/F9oI7pLoMzrJBdWlxJbT28i/MHR0IZWB5yDz3zzXrOsWUTw7s7TyQOjHPUmuavbQMQqNH5e4naOBz06cepzW8ZdepzyjZnzb8bP2Sdc8ZwtI994D8VXbbI0vfFfhOO51DjH37i2eLzTgkDeh6DJPNfJniz/gkH478aeILm6vPFfhe1jklZ/JsrA28UaluAsSqqLjpwO3Wv0/az8+6NurbRLjADEAnPQ+nA7dcnPaovEWgRwFlUrsUc/u9xORnvXTUrVKseSb0+QU2oPmj+R8TfAD/gnDH8J9La3k1ZtTkjBJb7i89QB+B/GvZtJ/Z407QxH5kca4xhh1B5x7+9evDT1gChvLVccAYXPoCfz/Kq9pbjcVDGRVDc54Q+nqfzrnVCC1Zcq1SXU828ffA7Qfi34MuPDvirS11XQbiWJ5baSV4/M8tw64aMh+GUZwR3HQmvg79urwBfT/HqxvtA0zQ9Q1DU0uv3V/DZskD+YWeR2dl3yDOV8xW2g4Ge36l2en286qxZvlIwoXjv+vvXhf7TnwE1LwB4h/tPTYLdNB1z/SLRryLfaTA/fhMn34pY2LLkHOAhwQeOyjFOLtuOg+WaUj8zvhx4U174QeLLfXLfUNPutS067+0+ZYLvXzR1iaVV24AyNq8DJ7V9I+Pf2hF19mks90MckSvu+83zAHBx0weMdK5D4oSPJfzabHavfKxZbUGUfbLd8nCfu+JRngcZOea6ib4J/wBh6i2npukmto4oXzjiYRoJV99sgdR6gCvlcyxyw1S1Lr+Z9TTy+NaknU0tt8zyXxZquoeJFkh86ZvMU7Sf4h6/y56/hUunfs6ap+0Z4L0bRbW40/TfFHhN7m0tW1SY20GtWE0vnxpHOf3aTQzPc5V8b0mTBJTA+m/hr+zYurW0U11aK4Jxh/ly3Xcff5iK9U074HR29pmyjg3RjBBQDOCMcD2JPP60sJjKs/emtGclejTpv929T87/ABD+wT8YvChuNOm8A+MPLvdheWKyNxHcKpyv72MsjLnkc44FfQHgj9mfU/gp8PNKTW5oLfXdQL3L6P5okubCDYnlvOFyE8xi+1Sc4RicZr6em8NXui2RtLWa6sbeYDdDaXctuH553KrBcdM9+a4XWPh1DYxs1raQ2LK2ZGjQlpCTySe5Bx19TSxcVUjaAU8Q4q0jmPAM0+j2kkc33WG5Wc4ZiOhz19/WtexvkkvF57g7gQSCOh+nf8Kh/s21slImltYZHIYea+0deD1B64rH1Dxpo+jT+XPqUccq5+WEB3b1wEDf0rzpYOU48tvwNo4izud40PmopaSSNGOCEbgZ5Bz1wavabbW5C/N5gJ3EkdCf/relcVoXxR80RpBputalvAXbbWEoAP8AwMD+dbOg+OI7rxVHo+qaXqWiahNB9qtFvETdcqrFW2EM3zDIyOCMiuaWDnF7ef8AmdCrxZ614U0KxPg3Ur9keTyF2hWIG7PH+NczZo0AZlPlhm4PG4Yx19evf+VdtaTW+nfC6a2jy1xcSD5x6ZPHoTiuZ0rRmh2xquFPLZ4G0+n5j+vairHZLsKm92ytkwXIbGFkOCS2OeM/5J7dKvKGlG2RYx/BkjK8e3rjPX0rVtdAkeVQNofafLVgCMAj8c9857VqWnhuSe7VX3GNQSML19f51lydi+YqaCjRnO6M4OVJ4xzgds89K6Wz0vfCoVVdt3G5iWX8PfpUMGjeSzf3m4HYkeuOcjn866DQbCVotyrIEXOARhh7de/5fhU8jRpGfchsdHmkKybB5cfRdo+ZT2B/Wrv9kyksp/csAFKqfve1bFj4eaGQ5EgVsrkZJxn8xyeta58KSxxb9qtK33ggxn/PJrspU7xOWpJJ2OWGhviPazO24LuPBbH/ALNV638PyvkGOZmDZDNjken/ANaut03w9vm8s7WkyuF2/N2/E/8A1q9E+Gv7N3iT4lanDDpeh3s2eTcOGighB9WbAxwOmTW0aN9DGVV30PGbXwrJcNu+yq3IwynqOev5dq1rP4b3d5KrRxRq4GWDA8fTt+dfdHw7/wCCbOnWEaTeItZmkk6m309QipkcjzHBJ59FGK9c8Jfso+AfB2xrfw/bXUy/8tbxmuWJ9cOSPyArpp4GRn7Rn5z+Bfgprniq4aPT9LuLxlOPLt4t+T74HH5969T8O/sGfELX41kfR1sRgki5ulQ+2Bk8/Wv0DsdOt9MgWK2t4beJRgJEgRR+Aqat45fH7TD2jPgfRv2B/Hsw3/2XaQbcgCa6XJ9up4/Guq8PfsTeINKuhLqnh86kqADy7fUkt93uX2sfy/Ovs6itI4Cmu4vaM+R7H9hDXtd1KSaWPSdAtZM7LdLh7jyRjAGTkt+Jr1T9rrS5rL4N6bIp8640m7t3DDjcyjGfxr2Ssnxpoo8QaK1sYbWYs6sBOu5VIIO4f7Q7e9c2YYKDwtSK3a3+Z6uT5lLDYyjWlrGEk7fn+Be0i4a70q1mYENLErkHqMgGrFNj/wBWMHPbPrTq9SHwo8mTu7oKKKKokKAcigjIrxLxB8StW+Fnj6/tvMa4sfNMghkOeG54/wD11w4zHwwzj7TaXXsdFDDyq3Ud0e0X1sL2ymhZmUTIUJXqMjHFfHHxB/aI+InwG+JdxpfiiSPxBpakiGN0SEtGPuyJIozuIPO/OSOx5r6b8CfG3RvG4WNZhaXXeKU4z9D3qz8T/g34d+MWkraa9p8d0sefKlUlJoSe6uOR9Oh7iqlJ14KeGn/l6M+g4dzHB4GvKjm2HVWjNWasuaP96D0s/Rq/fQ8u+Gvx6tvHeipfeHdSZmwTLZSMrSwY65TJ4/2l4+ldvonx1t4/l1WFoVzg3EILR+nI6j9a86h/4JzeGbDXIr6z17xFYyW774XhlRZoj2w4A5H0r1Gb4KWv9jLCt7dXF4i4NzOE3Tf74RVGfcAZ75rpw9aq1avFeqOPiDBZTSqKpk1aUov7M42cfntJfJP1Op0nW7XxDZrc2N1DcwP0aM7h/wDW+hor558bfCi+8P6rtVby1MmSWtydkuO/H1/WitXKn3f3Hz96n8p8O6WN15IvOI3wBmtPT0GyQ45XGD6cUUV1UNjy5bD4rh4lXa20ZPAHH3yP5VpWx3NKpzjd0z70UV1UyS9aqGg5AO4jP6ir1pAmxRtHzZz78f8A1qKKqpsa0znr793G7j72wnPvzVO+laKFtpxtCkexzRRXj1N0X1Kc0rSjcxyygkVY0I8B/wCLLH/IooqYblL/ADOwtwBbq2FDEZJAxRqkrNp68/8ALQD9AaKKvr9xU/1/yMGaQpclB91uoIzU3hIefdbGAZWDEjHp0oopGcS1qRxdtH/CEzj8ayVObtenzYzx7GiipjsaVBLoeXdKq8KHwBnjFMvpmEj8/wAWPw4oorZbP+uxn0+4x9ejUacjY+ZdoB9OO1cr4hjFhdzLDlVDcDOeo/zxRRW3b+uqOatt8kQ6OPO1ePdubjeMnodv+eOlS6u7FLhsktwNx64+tFFbw3/rsZ/8AzpY1eF2KpuC5+6OtN1KxhRJNsajAVunfcKKKuW39eQ49C8qrFIu1V+RlZcqDg5613XhzxZfaTcW+jRvDLpOrW0r3Vnc28dxBIycK2yRWCkDjKgEjrmiipyzXEJPz/I2xCXs16o+RfBerJb/AARuvFUOleG7XxI2qXluNRt9CsobhEWdkUKyRArheAVwR1zmsn4beBdJ1DVlmnsYppGfcS5J5z160UV8rjor6+1bp+rPqo6YdHrmmaRa2cirFDHGu7oBx0z/ADq/DpVuNSuJPLG/Yhzk+pH8uKKK9OG33foeHWdm7HiH7SfjrVtA+K2n6RY3slpp95CrzRxAKznbKc7wNw+6vQ9vrVfw/wDDDSfGhZ9V/tS+3LuKy6pdFSdoPK+Zg89sUUV14393Rg4aXXTTqznp6yd/60LD/A/wfo3mtb+HNJWSMB1drcSOD67myf1qvJpFrp6xi3toINpXHloFPUDqKKK8mpJy+Ly/M7qZoaNGtwY/M+bDsBntgHH8hXK/tVaVbw+D7PVkj26lo9/G9ncKSHgLKS2PUHA4ORwOKKK5cP8A7xH1/VHXL+G/67HqNxKyaUyr8qxoHVVG1QxxzgVq+FLKK+tvNkXdIrsAwOO2e1FFeZL7Py/Q647HRadZRSyLuQff7cdM4rQ0qFYvJZR94MTzwedvT6UUVr/wDHqW7RBsilx+8ZTk/gD06V1vhLS7e8ijMkKsenpwM0UVUdn6sJbnpHww8MWOr39tHcQeYsxAf52BYYPcHNfbnwv/AGTPh3eaDbXlx4Xs7qcqrE3Essyk4/usxX9KKK9DCRTdmc1TdM9Q0D4ceH/CsAi03Q9JsIx0W3tEjA/IVsJGsS7VVVX0AxRRXqqKWxA6iiimAUUUUAFFFFABVTU3KyQ47sc/lRRXBmn+6z+X5oun8Q/S5GltAWOTuYfqasUUVrgW3h6bf8q/IVT4mFFFFdRIV4P+07AieLIZFUBngG4+vJoor5/iRJ4aN/5l+TPSyv8AjfI8rEzQEMjMrK/BBwRXt37OHjPVNdb7NeXklxCkeVVgPl+hxmiivByCclieVPSyPSx0U6cm13PXqKKK++PmxGQP1AP1FFFFAH//2Q==